Difference between revisions of "Part:BBa K4197011"
Line 8: | Line 8: | ||
<h2>Introduction</h2> | <h2>Introduction</h2> | ||
− | <p> | + | <p>This part is composed of the gene coding for the DARPin E2_79 protein (see <a href="https://parts.igem.org/Part:BBa_K4197019">BBa_K4197019</a>) in fusion with the <i>lpp-ompA-N</i> gene (see <a href="https://parts.igem.org/Part:BBa_K1694002">BBa_K1694002</a>). This part was designed to link IgE at the surface of <i> E. coli</i> with the sfGFP as a reporter of the localisation of the fusion proteins. </p> |
+ | <p>The DARPin E2_79 protein has a strong affinity for the constant part of IgE (Baumann et al., 2010). It was merged to the membrane protein Lpp-OmpA-N of <i>E. coli</i> (see <a href="https://parts.igem.org/Part:BBa_K1694002">BBa_K1694002</a>) to display the DARPin on the surface of <i>E. coli</i>. This lipoprotein is the most abundant in the membrane of <i>E. coli</i> with 100,000 copies per cell (Ortiz-Suarez and al. 2016) and is often used to display proteins on the surface of bacteria (Yang and al. 2016). The sfGFP was chosen because it keeps its fluorescence even in extra-cellular conditions (see <a href="https://parts.igem.org/Part:BBa_K1694002">BBa_K1694002</a>).</p> | ||
<h2>Construction</h2> | <h2>Construction</h2> |
Revision as of 21:36, 8 October 2022
OmpA_DARPin
Gene fusion to express the DARPin-sfGFP fusion protein at the surface of E.coli.
Introduction
This part is composed of the gene coding for the DARPin E2_79 protein (see BBa_K4197019) in fusion with the lpp-ompA-N gene (see BBa_K1694002). This part was designed to link IgE at the surface of E. coli with the sfGFP as a reporter of the localisation of the fusion proteins.
The DARPin E2_79 protein has a strong affinity for the constant part of IgE (Baumann et al., 2010). It was merged to the membrane protein Lpp-OmpA-N of E. coli (see BBa_K1694002) to display the DARPin on the surface of E. coli. This lipoprotein is the most abundant in the membrane of E. coli with 100,000 copies per cell (Ortiz-Suarez and al. 2016) and is often used to display proteins on the surface of bacteria (Yang and al. 2016). The sfGFP was chosen because it keeps its fluorescence even in extra-cellular conditions (see BBa_K1694002).
Construction
Xxxxx xxxxx xxxxx xxxxxx xxxx
Xxxxxxxxx
Xxxxxxxxxxxxx
titre 2
Titre 3
Xxxxxxxxxx
- Forward : TAAGAAGGAGATATACCATGGCGGAAGCGGGTATCACC
- Reverse : CTCGAGTGCGGCCGCAAGCTTCGGATCGTCCTATGATGGAGG
Xxxxxxxxxx
- CForward : CGCGGCCGCTTCTAGAGCGGAAGCGGGTATCACC
- Reverse : AGCGGCCGCTACTAGTCGGATCGTCCTATGATGGAGG
titre 3
Titre 4
Xxxxxx
Titre 4
xxxxxxx
Titre 2
Xxxxxx
References
- Morag E, Lapidot A, Govorko D, Lamed R, Wilchek M, Bayer EA, Shoham Y: Expression, purification, and characterization of the cellulose-binding domain of the scaffoldin subunit from the cellulosome of Clostridium thermocellum. Applied and Environmental Microbiology 1995, 61:1980-1986.
- Nogueira ES, Schleier T, Durrenberger M, Ballmer-Hofer K, Ward TR, Jaussi R: High-level secretion of recombinant full-length streptavidin in Pichia pastoris and its application to enantioselective catalysis. Protein Expr Purif 2014, 93:54-62. DOI: 10.1016/j.pep.2013.10.015.
- Young TS, Schultz PG: Beyond the canonical 20 amino acids: expanding the genetic lexicon. J Biol Chem 2010, 285:11039-11044. DOI: 10.1074/jbc.R109.091306.
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 130
Illegal XbaI site found at 47 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 130
Illegal NheI site found at 92 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 130
Illegal BamHI site found at 124 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 130
Illegal XbaI site found at 47 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 130
Illegal XbaI site found at 47
Illegal AgeI site found at 832 - 1000COMPATIBLE WITH RFC[1000]