Difference between revisions of "Part:BBa K4047000"

m
(adding info)
Line 1: Line 1:
−
 
+
This is the forward primer for transaldolase. The overlap sequence (acacaggaaacagaccatgg) allows proper Gibson assembly with the pGEM-tal backbone. The intermediate aattc sequence preserves the EcoRI restriction digest site for confirmation testing. The annealing portion (ATGGCAGCGAATTTACTCGAAC) allows annealing to the WT S. elongatus PCC 7942 genome for proper
−
__NOTOC__
+
−
<partinfo>BBa_K4047000 short</partinfo>
+
−
 
+
−
e
+
−
 
+
−
test edit for team
+
−
 
+
−
<!-- Add more about the biology of this part here
+
−
===Usage and Biology===
+
−
 
+
−
<!-- -->
+
−
<span class='h3bb'>Sequence and Features</span>
+
−
<partinfo>BBa_K4047000 SequenceAndFeatures</partinfo>
+
−
 
+
−
 
+
−
<!-- Uncomment this to enable Functional Parameter display
+
−
===Functional Parameters===
+
−
<partinfo>BBa_K4047000 parameters</partinfo>
+
−
<!-- -->
+

Revision as of 17:45, 4 October 2021

This is the forward primer for transaldolase. The overlap sequence (acacaggaaacagaccatgg) allows proper Gibson assembly with the pGEM-tal backbone. The intermediate aattc sequence preserves the EcoRI restriction digest site for confirmation testing. The annealing portion (ATGGCAGCGAATTTACTCGAAC) allows annealing to the WT S. elongatus PCC 7942 genome for proper