Difference between revisions of "Promoters/Catalog/Eukaryotic/Repressible"
Line 1: | Line 1: | ||
[[Image:NegativePromoter.png|right|200px]] | [[Image:NegativePromoter.png|right|200px]] | ||
− | All the promoters on this page are ''E. coli'' promoters that are '''negatively regulated''' meaning that increased levels of at least one transcription factor (other than the sigma factor) will decrease the activity of these promoters. | + | All the promoters on this page are ''E. coli'' promoters that are '''negatively regulated''' meaning that increased levels of at least one transcription factor (other than the sigma factor) will decrease the activity of these promoters. Note that constitutive yeast promoters have their own [[Promoters/Catalog/Yeast/Constitutive|page]]. |
<br style="clear:both" /> | <br style="clear:both" /> | ||
+ | |||
+ | <parttable>promoter_eukaryote_miscellaneous_negative</parttable> | ||
+ | |||
+ | <html> | ||
+ | <style> | ||
+ | #assembly_plasmid_table {margin-left:auto;margin-right:auto; border: 3px solid #444444;} | ||
+ | #assembly_plasmid_table td {background-color:#eeeeee; padding: 5px; font-size: 12px;} | ||
+ | #assembly_plasmid_table th {background-color: #aaaaaa;padding: 5px; font-size:14px;} | ||
+ | </style> | ||
+ | </html> |
Revision as of 05:09, 23 December 2008
All the promoters on this page are E. coli promoters that are negatively regulated meaning that increased levels of at least one transcription factor (other than the sigma factor) will decrease the activity of these promoters. Note that constitutive yeast promoters have their own page.
Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
---|---|---|---|---|---|---|---|
BBa_I756015 | CMV Promoter with lac operator sites | . . . ttagtgaaccgtcagatcactagtctgcag | 663 | 1278 | Not in stock | ||
BBa_I756016 | CMV-tet promoter | . . . ttagtgaaccgtcagatcactagtctgcag | 610 | 1250 | Not in stock | ||
BBa_I756017 | U6 promoter with tet operators | . . . ggaaaggacgaaacaccgactagtctgcag | 341 | 1250 | Not in stock | ||
BBa_I756018 | Lambda Operator in SV-40 intron | . . . attgtttgtgtattttagactagtctgcag | 411 | 1253 | Not in stock | ||
BBa_I756019 | Lac Operator in SV-40 intron | . . . attgtttgtgtattttagactagtctgcag | 444 | 1244 | Not in stock | ||
BBa_I756020 | Tet Operator in SV-40 intron | . . . attgtttgtgtattttagactagtctgcag | 391 | 1244 | Not in stock | ||
BBa_I756021 | CMV promoter with Lambda Operator | . . . ttagtgaaccgtcagatcactagtctgcag | 630 | 1259 | Not in stock |