Promoters/Catalog/Yeast/Constitutive
All the promoters on this page are yeast promoters that are constitutive meaning that their activity is dependent on the availability of RNA polymerase holoenzyme, but is not affected by any transcriptional regulators. If you find any promoters on this page that you know to be regulated by a particular transcription factor, please let us know, or re-categorize the part yourself!
| Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
|---|---|---|---|---|---|---|---|
| BBa_I766555 | pCyc (Medium) Promoter | . . . acaaacacaaatacacacactaaattaata | 244 | 3344 | Not in stock | ||
| BBa_I766556 | pAdh (Strong) Promoter | . . . ccaagcatacaatcaactatctcatataca | 1501 | 3301 | Not in stock | ||
| BBa_I766557 | pSte5 (Weak) Promoter | . . . gatacaggatacagcggaaacaacttttaa | 601 | 3594 | Not in stock | ||
| BBa_J63005 | yeast ADH1 promoter | . . . tttcaagctataccaagcatacaatcaact | 1445 | 7638 | It's complicated | ||
| BBa_K105027 | cyc100 minimal promoter | . . . cctttgcagcataaattactatacttctat | 103 | 1876 | It's complicated | ||
| BBa_K105028 | cyc70 minimal promoter | . . . cctttgcagcataaattactatacttctat | 103 | 1833 | It's complicated | ||
| BBa_K105029 | cyc43 minimal promoter | . . . cctttgcagcataaattactatacttctat | 103 | 1832 | It's complicated | ||
| BBa_K105030 | cyc28 minimal promoter | . . . cctttgcagcataaattactatacttctat | 103 | 1832 | It's complicated | ||
| BBa_K105031 | cyc16 minimal promoter | . . . cctttgcagcataaattactatacttctat | 103 | 1832 | It's complicated | ||
| BBa_K122000 | pPGK1 | . . . ttatctactttttacaacaaatataaaaca | 1497 | 6078 | It's complicated | ||
| BBa_K124000 | pCYC Yeast Promoter | . . . acaaacacaaatacacacactaaattaata | 288 | 2076 | Not in stock | ||
| BBa_K124002 | Yeast GPD (TDH3) Promoter | . . . gtttcgaataaacacacataaacaaacaaa | 681 | 4340 | Not in stock | ||
| BBa_K319005 | yeast mid-length ADH1 promoter | . . . ccaagcatacaatcaactatctcatataca | 720 | 3236 | It's complicated | ||
| BBa_M31201 | Yeast CLB1 promoter region, G2/M cell cycle specific | . . . accatcaaaggaagctttaatcttctcata | 500 | 1858 | Not in stock |