Difference between revisions of "Collections/Best Composite Part"
m |
m |
||
| Line 1: | Line 1: | ||
{{Catalog/MainLinks}} | {{Catalog/MainLinks}} | ||
{{TOCright}} | {{TOCright}} | ||
| − | |||
A [[Help:Adding_Parts/Composite|composite part]] is a functional unit of DNA consisting of two or more basic parts assembled together. Generally, the Best Composite Part Award is given to a "device," a composite part that can function independently, without the need for further assembly. The iGEM community can improve upon these devices, use them as part of their designs, and/or use them as a foundation for new devices. | A [[Help:Adding_Parts/Composite|composite part]] is a functional unit of DNA consisting of two or more basic parts assembled together. Generally, the Best Composite Part Award is given to a "device," a composite part that can function independently, without the need for further assembly. The iGEM community can improve upon these devices, use them as part of their designs, and/or use them as a foundation for new devices. | ||
Revision as of 15:55, 16 July 2020
A composite part is a functional unit of DNA consisting of two or more basic parts assembled together. Generally, the Best Composite Part Award is given to a "device," a composite part that can function independently, without the need for further assembly. The iGEM community can improve upon these devices, use them as part of their designs, and/or use them as a foundation for new devices.
The following collection contains parts (and teams) that won, or were nominated, for the Best Composite Part award. Generally, these parts:
- are novel and/or provide a useful function
- are highly documented and characterized, with data and visualizations that show they work as expected
- adhere to the iGEM competition's requirements and the Registry's requirements for submissions
| Name | Description | Type | Created by | length | uses | seq |
|---|---|---|---|---|---|---|
| BBa_K1658000 | Cinnamyl alcohol dehydrogenase CAD1 | Composite | Şeniz Yksel, Burak Kızıl | 1231 | . . . tttatctgttgtttgtcggtgaacgctctc | |
| BBa_K1689010 | N-luc-dCas9 | Composite | ZHANG Yihao | 5630 | 1 | . . . ctgatgtcaagcgtgtacgaatttgataat |
| BBa_K1758377 | Biosensor device for detection of GHB and GBL | Composite | Team Bielefeld-CeBiTec 2015 | 1863 | . . . aagcttgggtaccgatcgcagaaagactaa | |
| BBa_K1890002 | Silicatein gene, fused to transmembrane domain of OmpA, with strong RBS | Composite | Lycka Kamoen, Maria Vazquez | 1481 | . . . gctagtgatgcctcctaccccactctctag | |
| BBa_K1991009 | Pcons-RBS-LO-AOX2-His | Composite | Chen, Pei-En | 2662 | . . . aggggttttttgctgaaaggaggaactata | |
| BBa_K1993009 | CXCR4-T2A-Luciferase-IRES-eGFP | Composite | Su Xiaojun | 3366 | . . . actctcggcatggacgagctgtacaagtaa | |
| BBa_K2206006 | Toehold switch for hsa-miR-15b-5p with GFPmut3b and inducible promoter | Composite | Sammy Lovat | 2014 | . . . catggcatggatgaactatacaaataataa | |
| BBa_K2259091 | SynORI inducible plasmid copy number device | Composite | Laurynas Karpus | 925 | . . . accgttggtagcggtggtttttttgtttgc | |
| BBa_K2306008 | Secretory-abundant heat soluble protein 33020 "SAHS 33020" (T7 promoter, RBS and double terminator) | Composite | Guillermo Serena Ruiz | 736 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2753018 | TALE2 sp1 | Composite | WEI KUANGYI | 3166 | . . . tcagaccggaaagcacatccggtgacagct | |
| BBa_K2770002 | ycdW generator | Generator | Luca Brenker, Peter Gockel, Maria Musillo, Elena Nickels, Jan Benedict Spannenkrebs | 1060 | . . . catcaccatcaccatcatcatcatcattaa | |
| BBa_K2796028 | Exosome booster | Coding | Shuangshuang Pu | 3874 | 2 | . . . tcccccggcaatcattacataaacagataa |
| BBa_K2932003 | PliaI + RBS + CA + terminator | Composite | Ping-Yi Chen | 1173 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2980009 | CIB1-GCN(4)-mEGFP-FUSLCD | Coding | Ji Gao | 1713 | . . . atcactctcggcatggacgagctgtacaag | |
| BBa_K3187000 | P22 Bacteriophage Coat Protein with LPETGG Tag for Sortase-mediated Ligation | Composite | iGEM TU_Darmstadt 2019 | 1650 | . . . tccggattggcgaatgggacgcgccctgta | |
| BBa_K3352006 | T7 + RBS SplintR Ligase Expressing Construct | Composite | Hannah Hsu | 1124 | -1 | . . . caccttcgggtgggcctttctgcgtttata |
| BBa_K3370601 | T7 promoter + LacO + RBS + Harmonized GR with linker and GFP + 6x His-tag + Terminator | Composite | CHIH-LU CHIANG | 1877 | -1 | . . . gactgtccacgacgctatacccaaaagaaa |
| BBa_K3407022 | Short hairpin RNA (shRNA) potential trigger of RNAi. Transcription controlled under T7 promoter. | Composite | Javier Navarro Delgado | 87 | -1 | . . . tgtaggtggcatcgccctcgccctcgccgg |
| BBa_K3512042 | Atmosphere Regulated Killswitch | Device | Gourav Saha | 958 | -1 | . . . caccttcgggtgggcctttctgcgtttata |
| BBa_K3758301 | T7 Universal Test Construct 7.0 | T7 | Michael Burgis | 823 | -1 | . . . cccggtaggggcccacgcttgttggagacg |
| BBa_K3893030 | Population control device (QS-based lysis protein oscilator) | Composite | Stefania Soledad Montesinos Ludena | 3200 | -1 | . . . ttcgggtgggcctttctgcgtttatacgct |
| BBa_K4011008 | CBM3-NT2RepCT-CBM3 | Coding | Zixiang Zhou | 1995 | -1 | . . . aatggtgttctggtttggggtaaagaaccg |
| BBa_K4150006 | T7P-g10.RBS-His-Ova-T7T | Composite | WEI CHIEH CHIN | 1363 | -1 | . . . gcctctaaacgggtcttgaggggttttttg |
| BBa_K4156101 | pLldR | Regulatory | Zheng Huang | 1361 | -1 | . . . gcacatccggtgacagctaaagaggagaaa |
| BBa_K4239008 | fiatlux genes with their promoter to emit luminescence | Translational_Unit | Guillaume FULCONIS | 5867 | -1 | . . . ttaagcttaaccgaagcgtttgatagttga |
| BBa_K4735014 | NarK promoter fused to sfGFP | Composite | Asha Keshavarz | 980 | -1 | . . . tttatctgttgtttgtcggtgaacgctctc |
| BBa_K4735015 | dmsA promoter driving superfolder GFP expression | Composite | Asha Keshavarz | 979 | -1 | . . . tttatctgttgtttgtcggtgaacgctctc |