Difference between revisions of "Part:BBa K3037005"

Revision as of 20:13, 21 October 2019

MBP+eGFP+dCas9

Overview

This BioBrick was designed as a composite BioBrick by the team TU Dresden 2019. It is a fusion of dCas9 (BBa_K3037002) and eGFP (BBa_K3037006)(more information).

The dCas9 can bind to any sequence of DNA specified by its guideRNA. The eGFP (enhanced reporter protein) is used as reporter, resulting in fluorescence emission at 530 nm [1].

Additionally, the BioBrick is designed to have a N-terminal Maltose-binding-protein (MBP) fused to it (BBa_K3037001).This improves the solubility and expression, thus the total cytoplasmic yield of the protein. The MBP can further be used to purify the fusion protein via an amylose resin and, afterwards it can be cleaved off by digestion with a PreScission protease.

The design of the here presented BioBrick is based on BBa_K1994025. The original composite BioBirck consists of a transcriptional fusion of GFP and dCas9, both having their own promoter and RBS. A terminator separates both units. However, from our perspective having two transcriptional units as a composite part makes little sense to couple dCas9 activity with an easy readout - such as GFP. Therefore our improvement was to fuse the dCas9 with eGFP to generate a translational fusion protein. We strongly believe that this improvement will be tremendously helpful for future iGEM teams working on dCas9 based projects. Down below, our characterization of the new improved composite part.

Characterization

Outline

We performed the following characterization experiments:

1) Prove of DNA-binding ability of dCas9 via Electrophoretic Mobility Shift Assay (EMSA)

2) Expression in BBa_K3037000, purification and tag-removal

3) Expression using pOCC97 (BBa_K3037000) in E. coli pRARE T7

Experiments in Detail

1) Prove of DNA-binding ability of dCas9 via EMSA

1. Materials:

• 100 ng of PCR amplified sry gene
• 200 ng of dCas9-GFP
• 200 ng of guide RNA specifically targeting the amplified sry gene
• 1 x Reaction buffer - 20 mM Hepes buffer (pH 7.2)
  • 100 mM NaCl
  • 5 mM MgCl2
  • 0.1 mM EDTA

Six different guide RNAs were designed for targeting different regions of sry gene. Using the online tool Benchling and Fasta sequence of sry gene

1: AACTAAACATAAGAAAGTGA

2: GAAAGCCACACACTCAAGAA

3: ACTGGACAACAGGTTGTACA

4: GTAGGACAATCGGGTAACAT

5: TTCGCTGCAGAGTACCGAAG

6: CCATGAACGCATTCATCGTG

Table 1: Overview of different guide RNAs with the context of the sequence and the PAM sequence

2. Methods:

1. We wanted to check if the overall efficiency of mobility shift increases when combinations of guide RNAs are used.

2. Guide RNA, dCas9-GFP and sry gene were incubated in reaction buffer (respective amounts mentioned in the materials section) for 37 °C for 1 hour.

3. Post incubation, they were mixed with loading dye without SDS, 20 % glycerol in Orange G dye and loaded onto 4-20 % gradient acrylamide- TBE precast gel. Gel was run for 3 hours at 75V in 1 x TBE buffer.

4. Gel was then stained using EtBR with 1:20000 dilution in 1x TBE for 10 minutes.

3.1 Results and Discussion of the 2 hours gel:

Figure 1: Electrophoretic Mobility Shift Assay (EMSA) after a two hour run using dCas9 with different guideRNAs

Lane 1+2 - There is a clear sry band at 800 base pairs and when the sry gene is incubated with only dCas9 without guideRNA. Over all, no shift is observed.

Lane 3 - When guideRNA 1 was incubated with the dCas9 DNA reaction mix, we saw a shift in the mobility, this is because of the protein DNA interaction and this binding is hindering the gene mobility.

Lanes 5,6,7,8 and 9 – Different combinations of guide RNAs were used. From lane 7 and 8 we see the highest mobility shift.

From the electromobility shift assay performed above, we conclude that our expressed dCas9-GFP protein is functional and is able to successfully bind to gene with the help of appropriate guideRNAs.

3.2 Results and Discussion of the 3 hours gel:

Figure 2: Electrophoretic Mobility Shift Assay (EMSA) after a three hour run of the dCas9 with different guideRNAs

This second gel was run longer in order to get rid of all the secondary structures derived from residual RNA fragments.

From lane 3 to 7, no difference in the mobility of sry gene can be seen when only guideRNA is added to the reaction mix.

In Lane 8, 9 and 10 a mobility shift of the gene can be observed and in lane 11, when only guideRNA was loaded no bands were obtained.

In lane 12, dCas9 is in the stacking part of gel, owing to higher molecular weight.

4. Conclusions:

- We have a functional dCas9 expressed, which is able to bind successfully to sry gene with the help of specific guideRNAs.

- dCas9 on its own is unable to bind to sry gene, proving that for binding at least one appropriate guideRNA is required.

- GuideRNAs on their own are unable to cause a mobility shift of the sry gene.

2) Expression in BBa_K3037000, purification and tag-removal

The protein was purified via amylose resin column with the a N-terminal-MBP-tag BBa_K3037001.

Amilose resin purification using MBP-tag. The upper arrow shows the location in the gel of this BioBrick (BBa_K3037005). The lower ones show the MBP-tag after beeing cleaved off

The comparison of lane 4 and 5 illustrates nicely the performance of the MPP-tag with the amylose resin. Upon elution in lane 5 many truncated versions appear. This was to be expected as it often occurs when expressing large recombinant proteins. The high intensity of the bands shows that previously these proteins were bound to the resin as they were not in lane 4. After the digestion with 3C protease, a very strong signal appears at 42 kDa inicating that the preScission sites are intact and were recognized. The purification of the complete transcript from the cleaved off tag was archieved by cation exchange chromatography on a HiTrap SP column.

3) Expression using pOCC97 (BBa_K3037000) in E. coli pRARE T7

Expression of different BioBricks in pOCC97

Sequence

NOTE: For some reason the specified scar when aploaded the sequence was the one of the RFC25 standard but the registry shows the one of the RFC23

References

[1] https://www.biotek.com/resources/technical-notes/excitation-and-emission-of-green-fluorescent-proteins/

[2] https://www.genscript.com/bacterial-soluble-protein-expression-MBP-tag.html

[3] https://www.gelifesciences.com/en/us/shop/chromatography/resins/affinity-tagged-protein/prescission-protease-for-gst-tag-removal-p-00248