Difference between revisions of "Part:BBa K2924008"

Latest revision as of 17:36, 21 October 2019

guideRNA from beta ketoacyl-acyl carrier protein synthase

beta ketoacyl-acyl carrier protein synthase fabF guide RNA of Synechocystis sp.

Usage and Biology

This part contains the beta ketoacyl-acyl carrier protein synthase guide RNA of Synechocystis sp. PCC 6803. It was used to create an induced knock-down of fabF via CRISPRi/dCas9-system, which was kindly provided Yao et al. (2015)¹. The beta ketoacyl-acyl carrier protein synthase can be found under the UniProt ID: FABF_SYNY3² and is involved in fatty acid biosynthesis and fatty acid metabolism³. The gene is positioned in the genome at 1669119 - 1670333 (1215 bp) bases ³. he guide RNA was obtained by using the CRISPR guide from benchling⁴. The sgRNA in the gene is located at 265 - 284 bp in the + strand (Fig. 1). The sequence of the sgRNA is gatcccgctgaacaaccctg, has anOn-Target Score of 72.8 and an Off-Target Score of 50.0.

Fig. 1: Position of sgRNA (orange) in the beta ketoacyl-acyl carrier protein synthase gene.

Fig. 2: Reaction catalyzed by ketoacyl-acyl carrier protein synthase.

The beta ketoacyl-acyl carrier protein synthase (FabF) is an enzyme participating in the fatty acid metabolism of different organisms such as plants or bacteria. It catalyzes the condensation during fatty acid synthesis by forming a carbon bond between Malonyl-ACP to an acyl acceptor of the acyl-[acyl-carrier-protein] (Fig. 2)⁵.

The short guide RNA (sgRNA) was cloned into a vector containing a neutral site of Synechocystis sp. PCC 6803. That’s a homologous sequence of its genome to ensure a knock-in into the genome (Fig. 3)¹.

In a general overview, the knock-in part contains a resistance for antibiotic and the sgRNA, which can be down-regulated by CRISPRi/dCas9 - system. This system is induced by anhydroTetracycline (aTc), which activates the synthesis of the dCas9, which is then binding to the sgRNA. These complex is able to bind complementary to the targeted enzyme and stops the transcription of it (Fig. 4).

Fig. 3: Scheme of a knock-in as a consequence of homologous recombination in Synechocystis.

Fig. 4: Scheme of function of the CRISPRi/dCas9 - system. The dCas9 (yellow) binds with the sgRNA to the complementary DNA strand and inhibits the transcription by RNA polymerase II (blue).

Sequence and Features

Characterization

For testing the created system the cultures were induced with aTc and the growth rates were documented for few days. To check the transcriptional activity on the targeted gene, a qPCR was performed from pelletized cultures. Finally, the varying percentage yields of fatty acids were measured via gas chromatography-mass spectrometry.

Proof of concept

Fig. 5: Fluorescence measurement of the mVenus knock-down (KD) strain in the plate reader 24 h after induction with 500 nM aTc (red) or 100% EtOH (negative control, blue). 2 biological and 3 technical replicates were cultured in 6-well plates.

This concept has been tested with the fluorescent protein mVenus. The sgRNA was designed using the “CRISPR Guides” tool on benchling⁴ by choosing suitable candidate sgRNAs, which binds at the start of mVenus and cloned it via homologous recombination into the genome of Synechocystis sp. PCC 6803. Furthermore, this Synechocystis sp. PCC 6803 was transformed with a plasmid containing the P_cpc560 BBa_K2924000 and the mVenus CDS BBa_K2924035.

Synechocystis sp. WT and Synechocystis sp. PCC 6803 with sgRNA_mVenus and pSHDY_P_cpc560_mVenus colonies were inoculated in BG11 medium with 20 µg/ml spectinomycin, 25 µg/ml kanamycin and 10 µg/ml chloramphenicol at 30°C and shaked with specific light and CO₂ conditions using 6 well plates. After 2 days of incubation, some cultures were induced with 500 nM aTc or with 100% EtOH as a control with the same amounts added. After 24 hours, the fluorescences were measured using a plate reader. Each sample was measured in biological duplicates, which are then tested in technically triplicates (Fig. 5).

As in Fig. 5 can be seen, the overall fluorescence decreased after induction with the inducer aTc. But in comparison to the empty vector control (EVC), fluorescence can be clearly measured. This proves our concept of down-regulating a protein or enzyme without abolishing the functions completely.

Synthase knock-down experiments

Fig. 6: Growth curve of <i>Synechocystis sp. PCC 6803 transformants after induction with 500 nM aTc over about 120 h.</i>

Fig. 7: The relative expression of different clones containing the same sgRNA for beta ketoacyl-acyl carrier protein synthase. The control resembles strains expressing the beta ketoacyl-acyl carrier protein synthase without induction of the sgRNA. The clones resemble strains expressing the beta ketoacyl-acyl carrier protein synthase with induction of the sgRNA targeting the gene.

After inoculation and incubation of Synechocystis sp. PCC 6803 transformants with sgRNA_synthase in BG11, were diluted to an OD₇₅₀ = 0.2 a few days later induced with an appropriate amount of 0.1 µg/ml aTc while the following antibiotics were added: 20 µg/ml spectinomycin and 25 µg/ml kanamycin. The cultures were incubated at 30°C and shaken with specific light and CO₂ conditions.

The expression levels for all of the transformants clones are lower as for the control (Fig. 7). This is caused by the CRISPRi/dCas9-Knockdown system. Clone 1 is the most promising transformant of the tested ones.

GC-MS

For the fatty acid composition analysis in Synechocystis sp., the transformants and a control were grown under the same grow conditions. 4 optical density units of cells, usually, an equivalent of 4 ml cells at OD₆₀₀ = 1, were isolated and used for extraction and derivatization of fatty acids. The extract was used for gas chromatography-mass spectrometry (GC-MS) (Fig. 8).

Fig. 8: Effect of CRISPRi/dCas9-system with the sgRNA of beta ketoacyl-acyl carrier protein synthase on the fatty acid profile and yield of different fatty acids. The control resembles a Synechocystis strain without down regulation. The clones resemble Synechocystis strains with downregulated beta ketoacyl-acyl carrier protein synthase.

No big difference between the transformant and the control in the fatty acid profile and yield could be observed if beta ketoacyl-acyl carrier protein synthase is downregulated (Fig. 8). Indicating, that the downregulation has no effect on the fatty acid composition of the cells.

References

[1]: YAO, Lun, et al. Multiple gene repression in cyanobacteria using CRISPRi. ACS synthetic biology, 2015, 5. Jg., Nr. 3, S. 207-212.

[2]: https://www.uniprot.org/uniprot/P73283

[3]: https://www.genome.jp/dbget-bin/www_bget?syz:MYO_115280+syz:MYO_17420

[4]: Benchling [Biology Software]. (2019). Retrieved from https://benchling.com.

[5]: D'AGNOLO, GIULIANO; ROSENFELD, I. S.; VAGELOS, P. R. Multiple forms of beta-ketoacyl-acyl carrier protein synthetase in Escherichia coli. Journal of Biological Chemistry, 1975, 250. Jg., Nr. 14, S. 5289-5294.