Difference between revisions of "Part:BBa K2319005:Design"

(→‎Design Notes)
(→‎Design Notes)
 
Line 8: Line 8:
 
===Design Notes===
 
===Design Notes===
 
<html>
 
<html>
−
<p><a href="https://parts.igem.org/Part:BBa_J18932">BBa_J18932</a> (mCherry RFP) has an interesting flaw: an internal ATG near the N-terminus has a RBS-like sequence preceding it; this hidden translation start site leads to ~50% truncation of the produced mCherry protein!</p>
+
<h3>HindIII, ATG, AgeI</h3>
  
−
<h2>Our Modification — Improved mCherry </h2>
+
<p>A HindIII restriction site, a start codon and an AgeI restriction site are added immediately downstream of the T7 promoter+RBS. A number of design considerations motivated the choice of these restriction sites. The HindIII site (A\AGCTT) — sandwiched between the RBS and the start codon — has a sequence very similar to the optimal sequence predicted by the sequence logo of <i>E. coli</i> ribosome binding sites, which can be found <a href="https://parts.igem.org/Help:Ribosome_Binding_Site">here</a>. In fact, the HindIII sequence is closer to the optimal sequence than the typical 5'-TACTAG-3' mixed SpeI-XbaI restriction site formed by BioBrick assembly, improving the initial ribosome-mRNA binding and improves translation.</p>
 +
 
 +
<p>The AgeI site was chosen to simplify assembly of fusion proteins in this backbone: by inserting a protein coding sequence at the N-terminus of the existing protein using the HindIII and AgeI sites, a fusion protein can be formed with a benign scar. The AgeI site (A\CCGGT) is translated in-frame to Thr-Gly, amino acids commonly used in linker sequences for fusion proteins. Threonine's hydroxyl group makes it hydrophilic — allowing stabilizing interactions with the aqueous cellular environment — while glycine's small size makes the linker more flexible, allowing both protein domains to fold independently. In addition, the AgeI site is useful if the user wishes to transfer an RFC25-compatible fusion protein (Freiburg format) into our expression system.</p>
 +
 
 +
 
 +
<h3>Our Modification — Improved mCherry </h3>
 +
 
 +
<p><a href="https://parts.igem.org/Part:BBa_J18932">BBa_J18932</a> (mCherry RFP) has an interesting flaw: an internal ATG near the N-terminus has a RBS-like sequence preceding it; this hidden translation start site leads to ~50% truncation of the produced mCherry protein!</p>
 
<p>Using an <i>in silico</i> analysis of RBS strengths using an online RBS Calculator, we modified the nucleotide sequence preceding the translation start site to become a far weaker RBS while maintaining the same amino acid sequence. This inhibits translation initiation at that position by almost 75% (predicted) and so reduces the truncation of the protein.</p>
 
<p>Using an <i>in silico</i> analysis of RBS strengths using an online RBS Calculator, we modified the nucleotide sequence preceding the translation start site to become a far weaker RBS while maintaining the same amino acid sequence. This inhibits translation initiation at that position by almost 75% (predicted) and so reduces the truncation of the protein.</p>
  

Latest revision as of 01:26, 2 November 2017


mCherry-SpyTag under T7 expression system


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal NheI site found at 828
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BamHI site found at 765
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Design Notes

HindIII, ATG, AgeI

A HindIII restriction site, a start codon and an AgeI restriction site are added immediately downstream of the T7 promoter+RBS. A number of design considerations motivated the choice of these restriction sites. The HindIII site (A\AGCTT) — sandwiched between the RBS and the start codon — has a sequence very similar to the optimal sequence predicted by the sequence logo of E. coli ribosome binding sites, which can be found here. In fact, the HindIII sequence is closer to the optimal sequence than the typical 5'-TACTAG-3' mixed SpeI-XbaI restriction site formed by BioBrick assembly, improving the initial ribosome-mRNA binding and improves translation.

The AgeI site was chosen to simplify assembly of fusion proteins in this backbone: by inserting a protein coding sequence at the N-terminus of the existing protein using the HindIII and AgeI sites, a fusion protein can be formed with a benign scar. The AgeI site (A\CCGGT) is translated in-frame to Thr-Gly, amino acids commonly used in linker sequences for fusion proteins. Threonine's hydroxyl group makes it hydrophilic — allowing stabilizing interactions with the aqueous cellular environment — while glycine's small size makes the linker more flexible, allowing both protein domains to fold independently. In addition, the AgeI site is useful if the user wishes to transfer an RFC25-compatible fusion protein (Freiburg format) into our expression system.

Our Modification — Improved mCherry

BBa_J18932 (mCherry RFP) has an interesting flaw: an internal ATG near the N-terminus has a RBS-like sequence preceding it; this hidden translation start site leads to ~50% truncation of the produced mCherry protein!

Using an in silico analysis of RBS strengths using an online RBS Calculator, we modified the nucleotide sequence preceding the translation start site to become a far weaker RBS while maintaining the same amino acid sequence. This inhibits translation initiation at that position by almost 75% (predicted) and so reduces the truncation of the protein.

BBa_J18932_mCherry      1 GTGAGCAAAGGCGAGGAAGATAACATG     27
                   |||...|||||.||.||||||||.|||
Improved_mCherry        1 GTGTCTAAAGGTGAAGAAGATAATATG     27

Source

This was assembled using existing BioBricks and some custom oligos to add specific sequences.

References