Difference between revisions of "Part:BBa K2040122"

(Usage and Biology)
(Usage and Biology)
Line 7: Line 7:
 
===Usage and Biology===
 
===Usage and Biology===
  
KillerRed([https://parts.igem.org/Part:BBa_K1184000 BBa_K1184000]) is a red fluorescent protein that produces reactive oxygen species (ROS) in the presence of yellow-orange light (540-585 nm). KillerRed is engineered from anm2CP to be phototoxic.  Expression of KillerRed and irradiation with light may act a kill-switch for biosafety applications. More details about KillerRed see [http://2013.igem.org/Team:Carnegie_Mellon/KillerRed 2013 Carnegie_Mellon].
+
KillerRed([https://parts.igem.org/Part:BBa_K1184000 BBa_K1184000]) is a red fluorescent protein that produces reactive oxygen species (ROS) in the presence of yellow-orange light (540-585 nm). It is engineered from anm2CP to be phototoxic.  Expression of KillerRed and irradiation with light may act a kill-switch for biosafety applications. More details about KillerRed see [http://2013.igem.org/Team:Carnegie_Mellon/KillerRed 2013 Carnegie_Mellon].
  
 
KillerRed effectively killed bacterial cells when exposed to white light for several minutes. However, in eukaryotic cells, irradiation of KillerRed localized in cell cytosol has a weak effect on cell survival<sup>[2]</sup>.
 
KillerRed effectively killed bacterial cells when exposed to white light for several minutes. However, in eukaryotic cells, irradiation of KillerRed localized in cell cytosol has a weak effect on cell survival<sup>[2]</sup>.

Revision as of 19:27, 18 October 2016


mRFP1 + TtrpC A SV40 nuclear localization signal was fused to the phototoxic protein KillerRed.

Usage and Biology

KillerRed(BBa_K1184000) is a red fluorescent protein that produces reactive oxygen species (ROS) in the presence of yellow-orange light (540-585 nm). It is engineered from anm2CP to be phototoxic. Expression of KillerRed and irradiation with light may act a kill-switch for biosafety applications. More details about KillerRed see [http://2013.igem.org/Team:Carnegie_Mellon/KillerRed 2013 Carnegie_Mellon].

KillerRed effectively killed bacterial cells when exposed to white light for several minutes. However, in eukaryotic cells, irradiation of KillerRed localized in cell cytosol has a weak effect on cell survival[2]. The following two ways have been found to be effective for killing the eukaryotic cells using KillerRed: (1) via an apoptotic pathway using KillerRed targeted to mitochondria, and (2) via membrane lipid oxidation using membrane-localized KillerRed. [2] Surely, one should select some ROS-sensitive intracellular localizations, such as mitochondria, plasma membrane, or chromatin to increase efficiency of KillerRed-mediated oxidative stress. So we tried to fused a SV40 nuclear localization signal(5' CCTCCCAAGAAGAAGCGCAAGGTC 3') to the KillerRed protein in order to let it locate in the nucleus containing chromatin.

We used __ cell to do this experiment.

References

[1]2013 Carnegie_Mellon ;http://2013.igem.org/Team:Carnegie_Mellon/KillerRed

[2]Genetically-encoded photosensitizer KillerRed; http://evrogen.com/products/KillerRed/KillerRed_Detailed_description.shtml


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BamHI site found at 715
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 1351
    Illegal AgeI site found at 555
    Illegal AgeI site found at 667
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 1065