Difference between revisions of "Part:BBa K2009430"
Line 66: Line 66:
  
 
Nature Protocols 10, 845-858 (2015).
 
Nature Protocols 10, 845-858 (2015).
 +
 +
<br>
 +
<p style="font-weight:bold; font-size:20px;">Results:</p>
 +
<br>
 +
This is the picture which shows E.coli containing the plasmid of sfGFP1-10 observed with white light and excitation light.
 +
<html>
 +
<img src="https://static.igem.org/mediawiki/parts/4/44/T--USTC--sfGFP1-10_BF.png" style="width: 60%;">
 +
</html>
 +
<html>
 +
<img src="https://static.igem.org/mediawiki/parts/5/56/T--USTC--sfGFP1-10_GFP.jpg" style="width: 60%;">
 +
</html>
 +
<br>
 +
This is the picture which shows E.coli containing the sfGFP11 plasmid and sfGFP1-10 plasmid observed with white light and excitation light.
 +
<html>
 +
<img src="https://static.igem.org/mediawiki/parts/f/fb/T--USTC--sfGFP11%2BsfGFP1-10_bf.jpg" style="width: 60%;">
 +
</html>
 +
<html>
 +
<img src="https://static.igem.org/mediawiki/parts/5/57/T--USTC--sfGFP11%2BsfGFP1-10_GFP.jpg" style="width: 60%;">
 +
</html>
 +
<br>
 +
If you want to see all pictures, please go to our notebook.
 +
<br>
 +
experimental data:
 +
<table border="1">
 +
<tr>
 +
  <td>sample</td>
 +
  <td>OD600</td>
 +
  <td>ABS</td>
 +
</tr>
 +
<tr>
 +
  <td>A10-1</td>
 +
  <td>2.541</td>
 +
  <td>8402</td>
 +
</tr>
 +
<tr>
 +
  <td>A10-2</td>
 +
  <td>1.486</td>
 +
  <td>5389</td>
 +
</tr>
 +
<tr>
 +
  <td>C11-1</td>
 +
  <td>2.539</td>
 +
  <td>9939</td>
 +
</tr>
 +
<tr>
 +
  <td>C11-2</td>
 +
  <td>2.230</td>
 +
  <td>8098</td>
 +
</tr>
 +
<tr>
 +
  <td>A+C-1</td>
 +
  <td>1.162</td>
 +
  <td>3078</td>
 +
</tr>
 +
<tr>
 +
  <td>A+C-2</td>
 +
  <td>1.077</td>
 +
  <td>2627</td>
 +
</tr>
 +
</table>
 +
  
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here

Revision as of 02:00, 16 October 2016

sfGFP1-10

Squence And Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal SapI.rc site found at 13

Introduction


sfGFP1-10——PSB1A3 length: 642bp
Derived from: PCR from Part:BBa_I746916，Cambridge 2008

sfGFP1-10——PSB1A3 is an expression plasmid which insertsfGFP1-10 into PSB1A3.

PSB1A3 is a high copy numberplasmid carrying ampicillin resistance. The replication origin is aPUC19-derived pMB1.

SfGFP1-10 is a part of GFP(from 1bp to 214bp), GFP has been mutated to improve its solubilityand self-associating activity. When it express, it will emit green fluorescenceslightly under the fluorescence microscope.

We try to find anideal protein tag to be work both invivo and invitro and it can provide a sensitive measurable signalwhich don’t need external chemical reagents or substrates. Finally we find away to accomplish this goal—— dividing GFP into sfGFP1-10and sfGFP11. Either the sfGFP1-10 or sfGFP11 will emit green fluorescence slightly under the fluorescencemicroscope. However, when sfGFP1-10 and sfGFP11 express insame cell, they will interact each other and emit more intense fluorescence thaneach of them. The split GFP system is simple and does not change fusion proteinsolubility.

Primers for these biobrickvectors can be found in part:
BBa_G00100 (aka VF2)
BBa_G00101 (akaVR)


The split GFP system has manypractical applications. Obtaining soluble, well-folded recombinant proteins fordownstream applications requires screening large numbers of protein variants (mutants,fragments, fusion tags, folding partners) and testing many expression orrefolding conditions.(Ste´phanieCabantous, Thomas C Terwilliger & Geoffrey S Waldo,2005)

Part Sequence

atgcgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggtaaactgacgctgaagttcatctgtactact ggtaaactgccggtaccttggccgactctggtaacgacgctgacttatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttccttta aggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatg tttacatcaccgccgataaacaaaaaaatggcattaaagcgaattttaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatca ctatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaa
(All the sequence has been testified by Sangon)

Assume Protein Structure

We used Phyre2 to get the assume structure:

(by PyMOL)

Citation:

The Phyre2 web portal for protein modeling, prediction and analysis

Kelley LA et al.

Nature Protocols 10, 845-858 (2015).


Results:


This is the picture which shows E.coli containing the plasmid of sfGFP1-10 observed with white light and excitation light.
This is the picture which shows E.coli containing the sfGFP11 plasmid and sfGFP1-10 plasmid observed with white light and excitation light.
If you want to see all pictures, please go to our notebook.
experimental data:

sample OD600 ABS
A10-1 2.541 8402
A10-2 1.486 5389
C11-1 2.539 9939
C11-2 2.230 8098
A+C-1 1.162 3078
A+C-2 1.077 2627