Difference between revisions of "Part:BBa K1890020"
Line 5: | Line 5: | ||
<h2>Indroduction</h2> | <h2>Indroduction</h2> | ||
Green fluorescent protein (GFP) from the jellyfish <i>Aequorea victoria</i>. This mutant represents a series of mutations resulting in enhanced maturation and emission [1]. It is expressed under control of the strong constitutive promoter <partinfo>BBa_J23100</partinfo>, strong RBS <partinfo>BBa_B0030</partinfo> and terminators <partinfo>BBa_B0010</partinfo> and <partinfo>BBa_B0012</partinfo>. | Green fluorescent protein (GFP) from the jellyfish <i>Aequorea victoria</i>. This mutant represents a series of mutations resulting in enhanced maturation and emission [1]. It is expressed under control of the strong constitutive promoter <partinfo>BBa_J23100</partinfo>, strong RBS <partinfo>BBa_B0030</partinfo> and terminators <partinfo>BBa_B0010</partinfo> and <partinfo>BBa_B0012</partinfo>. | ||
+ | This part belongs to the following part collection, consisting of GFP under five consitutive promoters with different strengths: | ||
+ | * <partinfo>BBa_K1890020</partinfo> | ||
+ | * <partinfo>BBa_K1890021</partinfo> | ||
+ | * <partinfo>BBa_K1890022</partinfo> | ||
+ | * <partinfo>BBa_K1890023</partinfo> | ||
+ | * <partinfo>BBa_K1890024</partinfo> | ||
+ | |||
+ | <h2><span class='h3bb'>Sequence and Features</span></h2> | ||
+ | <partinfo>BBa_K1890020 SequenceAndFeatures</partinfo> | ||
<h2>Construction</h2> | <h2>Construction</h2> | ||
Line 28: | Line 37: | ||
<figure> | <figure> | ||
− | <img src="https://static.igem.org/mediawiki/2016/4/45/T--TU_Delft--BBa_K1890020_construction.png" width=" | + | <img src="https://static.igem.org/mediawiki/2016/4/45/T--TU_Delft--BBa_K1890020_construction.png" width="70%"> |
<figcaption> | <figcaption> | ||
<b>Figure 1</b>: Construction of the biobrick K1890020 by means of two PCRs, using biobrick E0840 as a template. | <b>Figure 1</b>: Construction of the biobrick K1890020 by means of two PCRs, using biobrick E0840 as a template. | ||
</figcaption> | </figcaption> | ||
</figure> | </figure> | ||
− | |||
− | <h2>< | + | <h2>Characterization</h2> |
− | + | <p>In order to validate the fluorescence of the gene product, a fluorescence spectrum was measured at the excitation wavelength of 488 nm. The spectrum was recorded in a plate reader and for comparison, the results were normalized by dividing by the OD600.</p> | |
+ | |||
+ | </html> | ||
<h2>References</h2> | <h2>References</h2> |
Revision as of 19:00, 10 October 2016
GFP with strong constitutive promoter, RBS and terminator
Indroduction
Green fluorescent protein (GFP) from the jellyfish Aequorea victoria. This mutant represents a series of mutations resulting in enhanced maturation and emission [1]. It is expressed under control of the strong constitutive promoter BBa_J23100, strong RBS BBa_B0030 and terminators BBa_B0010 and BBa_B0012. This part belongs to the following part collection, consisting of GFP under five consitutive promoters with different strengths:
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 7
Illegal NheI site found at 30 - 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 700
Construction
This part is based on the part BBa_E0840, which already contains RBS, GFP gene and terminators. By means of PCR we added the strong constitutive promoter BBa_J23100. Two PCR reactions were performed with the following primers (Table 1).
Table 1: Primers used to add promoter to GFP BioBrick.
Primer name | Sequence |
---|---|
E0840_FW | ATTAAAGAGGAGAAATACTAGATGCGTAAAGG |
J23100-E0840_FW | CGGCGAATTCGCGGCCGCTTCTAGAGTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCATTAAAGAGGAGAAATACTAGATGCGTAAAGG |
VR | ATTACCGCCTTTGAGTGAGC |
To prevent annealing of the primer containing the promoter (J23100-E0840_FW), to the BioBrick prefix, a preliminary PCR was performed with a forward primer not containing the BioBrick prefix (E0840_FW) (Figure 1).
Characterization
In order to validate the fluorescence of the gene product, a fluorescence spectrum was measured at the excitation wavelength of 488 nm. The spectrum was recorded in a plate reader and for comparison, the results were normalized by dividing by the OD600.
References
[1] Cormack, B. P., Valdivia, R. H., & Falkow, S. (1996). FACS-optimized mutants of the green fluorescent protein (GFP). Gene, 173(1), 33-38.