Difference between revisions of "Part:BBa K1777005:Design"

Revision as of 07:50, 20 September 2015

flexible linker with SV40 NLS

Design Notes

The codon is optimized for mammalian, and we insert a NLS to promote locating in cell nucleus. Besides ,we lengthen this linker to provide better separation of two domains. At last we avoid tandem repeat sequence(like GGGSPKKKRKVGGGS), which will facilitate fusing this linker to your domains via overlap PCR.The first GGGS was replaced by a natural linker from linker database.[1] We are sorry for that we accidentally fused two identical linker tandemly in one part because of using the inappropriate assembly protocol.However, we have already proved that such a fusion has no influence on using this part by our protocol in the following.
This assembly protocol is suitable for fusing this linker to your target proteins via overlap PCR.Here we offer a primer design strategy to amplify this linker from the plasmid.After amplification,you can fuse the amplified linker with overlap region to your target proteins via overlap PCR(not shown in detail here).
primer design:
Forward primer: 5'- /-here enter the sequence of your overlap region of the upstream protein-/CCTCCTCCATACCAGCCTCTCCCC -3'
Reverse primer: 5'-/-here enter the sequence of your overlap region of the downstream protein-/GCTGCCGCCGCCGCC -3'
recommanded PCR reaction:
1 μl rTaq DNA polymerase(5 units)
4 μl dNTPs(10 millimoles each)
2 μl forward primer(primer solution is at 10μM concentration)
2 μl reverse primer(primer solution is at 10μM concentration)
1 μl template plasmid (no more than 50 ng)
5 ul 10x PCR buffer (according to your polymerase)
add water to 50 μl in total.
attention:it's important to keep a high concentration of primers in your reaction system.Because when the first cycle starts,excess primers will completely occupy all the four binding sites in each plamid,which will guarantee your product contains only single linker rather than tandem repeating linker as inserted in the plasmid.The anealing temperature of your PCR cycle is recommanded at 58.8 ℃
We validate this strategy using the following primer:
F:GTTTCTTCGAATTCGCGGCCGCTTCTAGAG CCTCCTCCATACCAGCCTCTCCCC
R:GTTTCTTCCTGCAGCGGCCGCTACTAGTA GCTGCCGCCGCCGCC
The product is analysed by AGE(agarose gel electrophoresis)[P1]which shows only single linker(117bp in length) is amplified.The tandem linker product(151bp)is nearly invisible.Futher sequencing validation will be updated several days later.
P1:

Source

This part is improved from BBa_K1486003.Detailed description is available at Part:BBa_K1486003:Experience[1]

References

linker database(http://www.ibi.vu.nl/programs/linkerdbwww/） George RA. and Heringa J. (2002) An analysis of protein domain linkers: their classification and role in protein folding. Protein Engineering 15, 871-879
Part:BBa_K1486003Go BBa_K1486003