Difference between revisions of "Part:BBa J31008:Design"
(No difference)
|
Latest revision as of 20:12, 15 February 2007
Design Notes
This part was PCR amplified from mRFP (BBa_E1010) using the following primers. The primers have non-annealing 5'- extensions that introduce a SpeI site to the left and an XbaI site to the right of the coding region (allowing BioBrick cloning in the reverse orientation). Primer annealing sites are shown in bold.
Forward: 5’ ATGCACTAGTATGGCTTCCTCCGAAGACGT
Reverse: 5’ GCATTCTAGATTAAGCACCGGTGGAGTGAC
The final part was cloned into vector pSB1A3. The Biobricks on this part are not wild type, but the cut sites are still viable.
| Standard BioBrick Cloning Sites (Knight) | 5'--GAATTC GCGGCCGC T TCTAGA G ----insert---- T ACTAGT A GCGGCCG CTGCAG-- 3'--CTTAAG CGCCGGCG A AGATCT C -------------- A TGATCA T CGCCGGC GACGTC-- |
| BBa_J31008 Cloning Sites | 5'--GAATTC GCGGCCGC T TCTAGA * --RFP coding-- * ACTAGT A GCGGCCG CTGCAG-- 3'--CTTAAG CGCCGGCG A AGATCT * -------------- * TGATCA T CGCCGGC GACGTC-- Prefix |