Difference between revisions of "Part:BBa K1722002"

Revision as of 12:49, 7 September 2015

hTERT is a tumor specific promoter.

hTERT is a tumor specific promoter which is short for human telomerase reverse transcriptase. The human telomerase enzyme complex consists of human telomerase reverse transcriptase(TERT), telomerase RNA(TR) and dyskerin(DKCI).^[1] This class of enzyme can catalyze the adding of (TTAGGG)n to the 3' end of telomeres to elongate the telomeres, thus prolonging cells' life. Researches show that the telomerase activity is based mostly on the expression level of TERT instead of that of TR and TEP. High telomerase activities are tested on most high proliferation cells such as tumor cells and stem cells. The core region of hTERT promoter lies on the 181bp sequence upstream of transcriptional start site, involving several binding sites for transcriptional factors, like sp1, cmyc, p53 and mad1. Researches show that hTERT promoters are activated in tumor cells that are telomerase positive while being inhibited in normal cells that are telomerase negative, which indicates that hTERT promoter may specifically target at tumor cells. Gu et al found the transcriptional activity of CMV promoter was almost 500 times higher than that of hTERT promoter in normal cells. However, the magnification shrinked to only 5-20 in tumor cells.

So in this study, we choose hTERT as a promoter to specifically recognise cancer cells to express the downstream effector. We constructed hTERT and GFP in the same plasmid and inserted the plasmid into T24, a bladder cancer cell line, to test if hTERT can be activated inside the cell. Luckily, we saw green fluorescent light using confocal laser scanning microscopy.

hTERT is 454bp in length. Fig. 1 shows the DNA sequence of hTERT is successfully amplified by PCR from psi-Check2 vector. From this electrophoretogram, we can see the brightness of hTERT PCR product is rather high compared with DNA Marker, which indicates that the PCR product of hTERT is in a high concerntration.

After ligating hTERT and pSB1C3, we transfected the new pasmid being constructed into Ecoli and selected those Ecoli with Chl resistence. Using these Ecoli as templet, we amplified hTERT from pSB1C3,(Fig. 2) which means we had successfly construacted the pSB1C3-hTERT plasmid.

We then performed single digest(EcoRI) and double digest(EcoRI & PstI) to identify our pSB1C3-hTERT plasmid.(Fig. 3) From the eletrophoretogram, we have two electrophoresis strips at about 454bp and 2070bp, which are exactly the length of hTERT and pSB1C3, respectively in Track 1 and a strip at about 2524bp in Track 2. From this enzyme cutting result, we could make sure the Gene sequence of hTERT succeeded in being constructed into pSB1C3 vector.

Sequence and Features

Design Notes

We designed the following primers and amplified hTERT promoter from the vector psi-Check2:Up: CCGGAATTCGGCACCTCCCTCGGGTTAG Down: TGCACTGCAGACTAGTCGCGTGGGTGGCCG. By incorporating these primers into hTERT promoter, the promoter is flanked by the iGEM prefix and suffix after amplification.

Source

The telomerase reverse transcriptase promoter can be found in human cancer cells. In our experiment, we got the part from Shenzhen Second People's Hospital. Additionally, the verification of our system's function was also carried out in Shenzhen Second People's Hospital.

References

[1] Cohen S, Graham M, Lovrecz G, Bache N, Robinson P, Reddel R (2007). "Protein composition of catalytically active human telomerase from immortal cells". Science 315 (5820): 1850–3.