Difference between revisions of "Part:BBa K5317022"
Annaseidler (Talk | contribs) (→FACS Analysis) |
Annaseidler (Talk | contribs) |
||
| Line 13: | Line 13: | ||
===Cloning=== | ===Cloning=== | ||
| − | This plasmid was engineered with NEBBuilder HIFI assembly method. First the backbone eGFP-C2neo was lineraized with AseI and BamHI, creating matching overhangs to the synthesized | + | This plasmid was engineered with NEBBuilder HIFI assembly method. First the backbone eGFP-C2neo was lineraized with AseI and BamHI, creating matching overhangs to the synthesized 3xCre3xAP1-miniCMV sequence and the miRFP670 gene in the backbone ensured seamless cloning with predetermined order. We have designed this sequence containing triplicates of the Cre binding site as well as the AP1 binding site to increase the signal intensity. To ensure an optimal gene expression of miRFP670 we clonded behind the recognition sequenz of ATF2 a mini-CMV-Promotor. The promoter insert was synthesized with the correct overhangs already. The miRFP670 reporter gene was amplifyied by PCR using the primers in table 1. |
<html> | <html> | ||
| Line 75: | Line 75: | ||
</html> | </html> | ||
| − | Figure 1: Assembled vector map with | + | Figure 1: Assembled vector map with 3xCre3xAP1-miniCMV-miRFP670 integrated into the pEGFP-C2 backbone. |
=Characterisation= | =Characterisation= | ||
| − | Transfection experiments in mammalian HEK293T cells assessed the promoter functionality, sensitivity and specifity. The fully assembled cell-based beta-lactam-sensor requires the successful triple-transduction with the detecting unit, CMV-EGFP-PknB, the signal transmitting unit, CMV-ATF2-mRuby2, and the receiving and signal translating into a fluorescence signal unit, the promoter | + | Transfection experiments in mammalian HEK293T cells assessed the promoter functionality, sensitivity and specifity. The fully assembled cell-based beta-lactam-sensor requires the successful triple-transduction with the detecting unit, CMV-EGFP-PknB, the signal transmitting unit, CMV-ATF2-mRuby2, and the receiving and signal translating into a fluorescence signal unit, the promoter 3xCre3xAP1-miniCMV-miRFP670. However, before all three are introduced into the cell and tested with antibiotic stimulation, its neccessary to test them alone and control any sensor-unrelated responses of the promoter. |
===Single-transfection experiments=== | ===Single-transfection experiments=== | ||
| Line 92: | Line 92: | ||
</html> | </html> | ||
| − | Figure 2: Representative microscopic images of HEK293T cells expressing | + | Figure 2: Representative microscopic images of HEK293T cells expressing 3xCre3xAP1-miniCMV-miRFP670. Shown are fluorescence channel for eGFP, mRuby and miRFP670. The basal activity of the promote is presented in the upper row. The promoter activity after induction with 100 µg/mL ampicillin for four hours is demostrated in the lower row. |
The single-transfection experiment with the promoter and with or without the presence of beta-lactams demonstrated no unspecific signals from the miRFP670 in the green or lower red channels. The specific miRFP670 signal did not increase after incubation with ampicillin es expected since the signal detecting and transmitting units are not present in the cell. Rather less cells demonstrated a miRFP670 signal with ampicillin incubation. But its important that this could ba a result of different transfection efficiencies in the representative wells. | The single-transfection experiment with the promoter and with or without the presence of beta-lactams demonstrated no unspecific signals from the miRFP670 in the green or lower red channels. The specific miRFP670 signal did not increase after incubation with ampicillin es expected since the signal detecting and transmitting units are not present in the cell. Rather less cells demonstrated a miRFP670 signal with ampicillin incubation. But its important that this could ba a result of different transfection efficiencies in the representative wells. | ||
| Line 98: | Line 98: | ||
===Triple-transfection experiments=== | ===Triple-transfection experiments=== | ||
| − | To actually test the functionality of the cell-based beta-lactam-sensor, HEK293T cells were triple-transfected with all neccessary parts for signal detection (EGFP-PknB), signal transmission (ATF2-mRuby2) and signal emittance ( | + | To actually test the functionality of the cell-based beta-lactam-sensor, HEK293T cells were triple-transfected with all neccessary parts for signal detection (EGFP-PknB), signal transmission (ATF2-mRuby2) and signal emittance (3xCre3xAP1-miniCMV-miRFP670) and the fluorescence signals analysed via microscopy and later on FACS analysis. |
<html> | <html> | ||
| Line 107: | Line 107: | ||
</html> | </html> | ||
| − | Figure 3: Representative microscopy image of HEK293T cells expressing EGFP-PknB, ATF2-mRuby2 and | + | Figure 3: Representative microscopy image of HEK293T cells expressing EGFP-PknB, ATF2-mRuby2 and 3xCre3xAP1-miniCMV-miRFP670. Shown are the fluorescence channels for EGFP, mRuby2 and miRFP670 (first three images from the left) and an overlay of the three channels (right). In a) is shown the basal activity of the promoter. In b) is shown the promoter activity after induction with 100 µg/mL ampicillin after four hours of incubation. |
The representative images in figure 3 show nicely the correct localizations of all three sensor components with EGFP-PknB beeing mostly localized in the membrane regions, the mRuby2-ATF2 singal beeing emitted from the nucleus and the miRFP670 from the nucleocytoplasm. The detectable miRFFP670 signal even without the presence of ampicillin could be explained by possible binding of ATF2 to the 3xCre3xAP1-sites after its activation via other mammalian mechanisms, since ATF2 is a mmamalian transcription factor and possibly andogenously expressed and active. Nevertheless, the representative images of the miRFP670 channel indicate a increase in fluorescene intesity after ampicillin incubation suggesting a functional PASTA domain activity followed by ATF2 phosphorylation leading to miRFP670 expression. | The representative images in figure 3 show nicely the correct localizations of all three sensor components with EGFP-PknB beeing mostly localized in the membrane regions, the mRuby2-ATF2 singal beeing emitted from the nucleus and the miRFP670 from the nucleocytoplasm. The detectable miRFFP670 signal even without the presence of ampicillin could be explained by possible binding of ATF2 to the 3xCre3xAP1-sites after its activation via other mammalian mechanisms, since ATF2 is a mmamalian transcription factor and possibly andogenously expressed and active. Nevertheless, the representative images of the miRFP670 channel indicate a increase in fluorescene intesity after ampicillin incubation suggesting a functional PASTA domain activity followed by ATF2 phosphorylation leading to miRFP670 expression. | ||
| Line 123: | Line 123: | ||
| − | Figure 4: Quantitive validation of reporter activity by flow cytometry analysis. The percentage of cells expressing the fluorophore under the control of the tested | + | Figure 4: Quantitive validation of reporter activity by flow cytometry analysis. The percentage of cells expressing the fluorophore miRFP670 under the control of the tested 3xCre3xAP1-miniCMV promoter is displayed as a function of various concentrations of ampicillin. n=1. |
| − | The quantification of the miRFP670-posive cells dependent on the beta-lactam concentration present in the medium for four hours shows a high basal activity of the | + | The quantification of the miRFP670-posive cells dependent on the beta-lactam concentration present in the medium for four hours shows a high basal activity of the 3xCre3xAP1-miniCMV promoter (approx. 70 % miRFP670-positive cells), as mentioned, possibly caused by endogenously active ATF2 or other transcription factors interacting with Cre and/or AP1 proteins-binding sites, activating our promoter independent of the presence of ampicillin. Nevertheless, the percentage of miRFP670-expressing cells increased slightly with ampicillin supplementation of the culture media. The bars indicate that the sensitivity of the sensor-casette, depicting already approx. 79 % miRFP670-positive cells under stimulation with 2.5 µg/mL ampicillin and no further increase with rising ampicillin concentrations. |
In conclusion, the evaluation of the sensor is made more difficult by a high baseline, but it is also characterised by a high sensitivity to beta-lactams. However, it must be taken into account that the experiment could only be carried out once due to time constraints. | In conclusion, the evaluation of the sensor is made more difficult by a high baseline, but it is also characterised by a high sensitivity to beta-lactams. However, it must be taken into account that the experiment could only be carried out once due to time constraints. | ||
Revision as of 13:01, 1 October 2024
3xCre3xAP1-miniCMV-miRFP670
Usage and Biology
When ß-lactams bind to the PASTA domain of PknB, its kinase domain phosphorylates ATF2, which then binds to our promoter. The promoter was identified by (Miller et al., 2010) as cyclic AMP responsive element (Cre)-sequence. ATF2-binding site is a consensus: 5-GTGACGT[AC][AG]-3) cAMP response element (CRE) (Hai et al., 1989). Based on observations made by Miller and colleagues (2010) showing similar kinase mechanisms between the prokaryotic PknB and eukaryotic MAPK towards ATF2, we generated a synthetic ATF2-responsive promoter construct with three Cre and three AP1 binding sites as well as a miniCMV promoter sequence. ATF2 was identified as the best PknB interaction partner. As with all our constructs, our promoter is followed by a fluorescent marker gene miRFP670 to detect specific activation
Cloning
Theoretical Part Design
We placed the miRFP670 fluorescent marker (K5317002) downstream behind this synthetic promotor (K5317017).
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 1132
- 12INCOMPATIBLE WITH RFC[12]Illegal PstI site found at 1132
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 788
- 23INCOMPATIBLE WITH RFC[23]Illegal PstI site found at 1132
- 25INCOMPATIBLE WITH RFC[25]Illegal PstI site found at 1132
Illegal NgoMIV site found at 451
Illegal NgoMIV site found at 739
Illegal NgoMIV site found at 774 - 1000COMPATIBLE WITH RFC[1000]
Cloning
This plasmid was engineered with NEBBuilder HIFI assembly method. First the backbone eGFP-C2neo was lineraized with AseI and BamHI, creating matching overhangs to the synthesized 3xCre3xAP1-miniCMV sequence and the miRFP670 gene in the backbone ensured seamless cloning with predetermined order. We have designed this sequence containing triplicates of the Cre binding site as well as the AP1 binding site to increase the signal intensity. To ensure an optimal gene expression of miRFP670 we clonded behind the recognition sequenz of ATF2 a mini-CMV-Promotor. The promoter insert was synthesized with the correct overhangs already. The miRFP670 reporter gene was amplifyied by PCR using the primers in table 1.
| Primer name | Sequence |
|---|---|
| miRFP670_fw | tgccaccatggtagcaggtcatgc |
| miRFP670_rv | TCAGTTATCTAGATCCGGTGtcagctctcaagcgcggtga |
Figure 1: Assembled vector map with 3xCre3xAP1-miniCMV-miRFP670 integrated into the pEGFP-C2 backbone.
Characterisation
Transfection experiments in mammalian HEK293T cells assessed the promoter functionality, sensitivity and specifity. The fully assembled cell-based beta-lactam-sensor requires the successful triple-transduction with the detecting unit, CMV-EGFP-PknB, the signal transmitting unit, CMV-ATF2-mRuby2, and the receiving and signal translating into a fluorescence signal unit, the promoter 3xCre3xAP1-miniCMV-miRFP670. However, before all three are introduced into the cell and tested with antibiotic stimulation, its neccessary to test them alone and control any sensor-unrelated responses of the promoter.
Single-transfection experiments
The composite part carrying plasmid was introduced via transfection to establish a baseline of endogenous promoter activity before performing co-transfection experiments with the CMV-ATF2-mRuby2 (composite part K5317016) and CMV-EGFP-PknB carrying plasmid (composite part K5317013) for ampicillin stimulation. The EGFP, mRuby and miRFP650 fluorescence signal was analyzed for presence and localization by microscopy.
Figure 2: Representative microscopic images of HEK293T cells expressing 3xCre3xAP1-miniCMV-miRFP670. Shown are fluorescence channel for eGFP, mRuby and miRFP670. The basal activity of the promote is presented in the upper row. The promoter activity after induction with 100 µg/mL ampicillin for four hours is demostrated in the lower row.
The single-transfection experiment with the promoter and with or without the presence of beta-lactams demonstrated no unspecific signals from the miRFP670 in the green or lower red channels. The specific miRFP670 signal did not increase after incubation with ampicillin es expected since the signal detecting and transmitting units are not present in the cell. Rather less cells demonstrated a miRFP670 signal with ampicillin incubation. But its important that this could ba a result of different transfection efficiencies in the representative wells.
Triple-transfection experiments
To actually test the functionality of the cell-based beta-lactam-sensor, HEK293T cells were triple-transfected with all neccessary parts for signal detection (EGFP-PknB), signal transmission (ATF2-mRuby2) and signal emittance (3xCre3xAP1-miniCMV-miRFP670) and the fluorescence signals analysed via microscopy and later on FACS analysis.
Figure 3: Representative microscopy image of HEK293T cells expressing EGFP-PknB, ATF2-mRuby2 and 3xCre3xAP1-miniCMV-miRFP670. Shown are the fluorescence channels for EGFP, mRuby2 and miRFP670 (first three images from the left) and an overlay of the three channels (right). In a) is shown the basal activity of the promoter. In b) is shown the promoter activity after induction with 100 µg/mL ampicillin after four hours of incubation.
The representative images in figure 3 show nicely the correct localizations of all three sensor components with EGFP-PknB beeing mostly localized in the membrane regions, the mRuby2-ATF2 singal beeing emitted from the nucleus and the miRFP670 from the nucleocytoplasm. The detectable miRFFP670 signal even without the presence of ampicillin could be explained by possible binding of ATF2 to the 3xCre3xAP1-sites after its activation via other mammalian mechanisms, since ATF2 is a mmamalian transcription factor and possibly andogenously expressed and active. Nevertheless, the representative images of the miRFP670 channel indicate a increase in fluorescene intesity after ampicillin incubation suggesting a functional PASTA domain activity followed by ATF2 phosphorylation leading to miRFP670 expression.
FACS Analysis
FACS analysis enable the quantification of the miRFP670-positive cells. In order to exclude single- and double-transfected cells from the evaluation, the cells were pregated regarding their EGFP- and mRuby2-positivity, counting only cells which carry the CMV-EGFP-PknB-C2, CMV-ATF2-mRuby2-C2 and promoter plasmid. The cells were incubated with varying, increasing concetrations of ampicillin to stimulate the miRFP670 expression via our sensor-cascade.
Figure 4: Quantitive validation of reporter activity by flow cytometry analysis. The percentage of cells expressing the fluorophore miRFP670 under the control of the tested 3xCre3xAP1-miniCMV promoter is displayed as a function of various concentrations of ampicillin. n=1.
The quantification of the miRFP670-posive cells dependent on the beta-lactam concentration present in the medium for four hours shows a high basal activity of the 3xCre3xAP1-miniCMV promoter (approx. 70 % miRFP670-positive cells), as mentioned, possibly caused by endogenously active ATF2 or other transcription factors interacting with Cre and/or AP1 proteins-binding sites, activating our promoter independent of the presence of ampicillin. Nevertheless, the percentage of miRFP670-expressing cells increased slightly with ampicillin supplementation of the culture media. The bars indicate that the sensitivity of the sensor-casette, depicting already approx. 79 % miRFP670-positive cells under stimulation with 2.5 µg/mL ampicillin and no further increase with rising ampicillin concentrations.
In conclusion, the evaluation of the sensor is made more difficult by a high baseline, but it is also characterised by a high sensitivity to beta-lactams. However, it must be taken into account that the experiment could only be carried out once due to time constraints.
References
Hai, T. W., Liu, F., Coukos, W. J., & Green, M. R. (1989). Transcription factor ATF cDNA clones: An extensive family of leucine zipper proteins able to selectively form DNA-binding heterodimers. Genes & Development, 3(12b), 2083–2090. https://doi.org/10.1101/gad.3.12b.2083
Miller, M., Donat, S., Rakette, S., Stehle, T., Kouwen, T. R. H. M., Diks, S. H., Dreisbach, A., Reilman, E., Gronau, K., Becher, D., Peppelenbosch, M. P., Van Dijl, J. M., & Ohlsen, K. (2010). Staphylococcal PknB as the First Prokaryotic Representative of the Proline-Directed Kinases. PLoS ONE, 5(2), e9057. https://doi.org/10.1371/journal.pone.0009057