Difference between revisions of "Part:BBa K5317011"

(→‎Cloning)
Line 84: Line 84:
  
 
=Characterization=
 
=Characterization=
 +
 +
Transfection experiments in mammalian HEK293T cells assessed the promoter functionality and sensitivity. First, the composite part carrying plasmid was introduced via transfection to establish a baseline of endogenous promoter activity before performing co-transfection experiments with the CMV-MTF-1-mRuby2 carrying plasmid (composite part <span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317012 K5317012]</span>) under varying copper concentration for stimulation. The EGFP fluorescence signal was analyzed for localization by microscopy and intensity by FACS analysis.
 +
 +
===Single-transfection experiments===
  
 
<html>
 
<html>
Line 93: Line 97:
  
 
Figure 2: HEK293T cells single-transfected with the MREdada-EGFP-C2 plasmid exhibited no EGFP-signal under unstimulated condiotions. Scale bar = 20 µm.
 
Figure 2: HEK293T cells single-transfected with the MREdada-EGFP-C2 plasmid exhibited no EGFP-signal under unstimulated condiotions. Scale bar = 20 µm.
 +
 +
The single transfection with the MREdada-EGFP-C2 plasmid in HEK293T cells showed no base signal without the co-transfection with the CMV-MTF1-mRuby2 plasmid and no metal ion stimulation. The experiments allow conclusions about sensitivity and specificity of the promoter under homeostatic conditions. In conclusion, the generated promoter has no unspecific expression by for example other, under homeostatic conditions active, transcription factors. The possible endogenous expression of MTF-1 is also not enough to generate a fluorescent signal under unstimulated conditons.
 +
 +
===Co-transfection experiments with MTF-1===
  
 
=Reference=
 
=Reference=

Revision as of 08:07, 29 September 2024


MREdada-EGFP

Usage and Biology

The MRE-sites containing promoter enables the metal-dependent expression of the downstream positioned reporter gene EGFP via the metal ion-dependent transcription factor MTF-1 for cell-based metal detection.

In order to integrate the findings of Searle and colleagues (1985) and Wang and colleagues (2004) regarding the metal inducibility of a promoter with two MREa sites and a high affinity between MREd and MTF-1, we designed a synthetic promoter with two MREa and two MREd sites that alternate. The aim is to enhance the sensitivity and efficiency of the metal-dependent promoter.

Cloning

Theoretical Part Design

Placing the MREdada promoter upstream of the reporter gene EGFP allows the visualization of primarily metal-dependent activation of MTF-1.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]

Cloning

To test the MREdada promoter functionality the reporter gene EGFP (K3338006) was cloned downstream of the promoter by inserting the MREdada promoter into the AseI- and NheI-digested EGFP-C2 backbone (K3338020) using NEB Hifi Assembly.

HTML Table Caption Table1: Primers used to create matching overhangs on promoter amplicon to digested pEGFP-C2 backbone

Primer name Sequence
MREdada_fw CCGCCATGCATTAGTTATGCACACTGGCGCT
MREdada_rev TGGCGACCGGTAGCGGACGCTTAGAGGACAGC
The vector map of the assembled construct is shown in figure 1.

Figure 1: The vector map depicts the integration of the MREdada promoter into the pEGFP-C2 backbone, placing it upstream of the reporter gene EGFP.

Characterization

Transfection experiments in mammalian HEK293T cells assessed the promoter functionality and sensitivity. First, the composite part carrying plasmid was introduced via transfection to establish a baseline of endogenous promoter activity before performing co-transfection experiments with the CMV-MTF-1-mRuby2 carrying plasmid (composite part K5317012) under varying copper concentration for stimulation. The EGFP fluorescence signal was analyzed for localization by microscopy and intensity by FACS analysis.

Single-transfection experiments

Figure 2: HEK293T cells single-transfected with the MREdada-EGFP-C2 plasmid exhibited no EGFP-signal under unstimulated condiotions. Scale bar = 20 µm.

The single transfection with the MREdada-EGFP-C2 plasmid in HEK293T cells showed no base signal without the co-transfection with the CMV-MTF1-mRuby2 plasmid and no metal ion stimulation. The experiments allow conclusions about sensitivity and specificity of the promoter under homeostatic conditions. In conclusion, the generated promoter has no unspecific expression by for example other, under homeostatic conditions active, transcription factors. The possible endogenous expression of MTF-1 is also not enough to generate a fluorescent signal under unstimulated conditons.

Co-transfection experiments with MTF-1

Reference

Searle, P. F., Stuart, G. W., & Palmiter, R. D. (1985). Building a metal-responsive promoter with synthetic regulatory elements. Molecular and cellular biology, 5(6), 1480–1489. https://doi.org/10.1128/mcb.5.6.1480-1489.1985

Wang, Y., Lorenzi, I., Georgiev, O., & Schaffner, W. (2004). Metal-responsive transcription factor-1 (MTF-1) selects different types of metal response elements at low vs. high zinc concentration. Biological chemistry, 385(7), 623–632. https://doi.org/10.1515/BC.2004.077