Revision as of 04:41, 1 September 2023

T7-RBS-SpyTag-GFP-SpyCatcher-Tr

SpyRing cyclization technique to enhance enzyme thermal resilience was clarified by Dr. Mark Howarth’s team¹. SpyRing harbors genetically modified SpyTag (13 amino acids) on the N-terminus and SpyCatcher (12kDa) on the C-terminus on the protein of interest. This context spontaneously reacts together through an irreversible isopeptide bond. SpyRing cyclization was demonstrated successfully to increase stress resilience of β-lactamase and some industrially important enzymes.

THERMOSTABILITY OF WILD-TYPE GFP

The BioBrick pT7-eGFP (Part:BBa_K1833000) comprises a T7 promoter, RBS, and terminator, with an inserted gene of GFPmut3b. This plasmid was retransformed into E. coli BL21. Upon 0.3 mM IPTG induction at 25°C for 20 hrs, bacterial lysates underwent heat tests at varied temperatures for 3 minutes, as indicated in Figure 1. Relative to the untreated control, fluorescence fold change depicted thermostability trends from 70°C, 80°C, to 90°C, retaining 59%, 12%, and 1% of the GFP signal, respectively. This data provided insights into the innate heat tolerance properties of GFPmut3b protein.

Figure 1. Thermostability of GFPmut3b protein. E. coli BL21 transformed with BBa_K1833000 was induced using 0.3 mM IPTG at 25°C for 20 hrs. Bacterial lysates were subjected to temperatures of 70°C, 80°C, and 90°C for 3 min each. Subsequently, the fluorescence of 100μl from each treated lysate was measured at Ex/Em = 483/513 nm. All values were normalized to the average of the untreated control, with the resulting ratio representing the fluorescence fold change.

THERMOSTABLE CYCLIZED SPYTAG-GPF-SPYCATCHER

Plasmid Construction

To enhance the thermostability of the GFP protein, we deleted start (ATG) codon and stop (TAA) codon, and incorporated SpyTag at the N-terminus and SpyCatcher at the C-terminus. This DNA fragment was synthesized by Integrated DNA Technologies, Inc. (IDT) and then cloned into pSB1C3 (SpyTag-GFP-SpyCatcher, Basic Part:BBa_K4652000). Then, the part was connected with a T7 promoter (Part:BBa_K1833999), a strong RBS (Part:BBa_B0030), and a double terminator (Part:BBa_B0015). This setup mirrored the context of pT7-eGFP (Part:BBa_K1833000), with the exception of the added SpyTag and SpyCatcher. The final construct was verified using colony PCR (Figure 2) and further validated through DNA sequencing. This resultant construct was designated as the improved BioBrick part, pT7-SpyTag-GFP-SpyCatcher (Composite Part:BBa_K4652002).

Figure 2. Verification of pT7-SpyTag-eGFP-SpyCatcher (Part:BBa_K4652002) using colony PCR. PCR was performed using a CmR-specific forward primer from the vector and a SpyCatcher-specific reverse primer from the gene. The expected size of the amplified DNA fragments is 2204 bp. The rightmost lane displays a 1 kb DNA ladder. The numbers correspond to selected colonies, with one control derived from a mock pick from a clear zone on the plate.

Thermostability of SpyTag-GFP-SpyCatcher

90°C treatment

To assess whether the thermostability of GFP was enhanced by the addition of SpyTag and SpyCatcher, lysates from the transformed E. coli BL21, induced with IPTG, were subjected to a heat tolerance test at 90°C – a temperature known to degrade wild-type GFP (as depicted in Figure 1 in CONTRIBUTION). As illustrated in Figure 3, despite a pronounced decline in activity within the first minute of treatment, the fluorescence intensities remained relatively consistent up to 3 minutes. The retention of 22% GFP activity indicates a marked improvement in thermostability compared to the mere 1% observed for wild-type GFP at 90°C after 3 minutes (Figure 4).

Figure 3. Thermostability of cyclized SpyTag-GFPmut3b-SpyCatcher protein at 90°C. E. coli BL21 transformed with BBa_K4652002 was induced using 0.3 mM IPTG at 25°C for 20 hrs. Bacterial lysates were subjected to 90°C treatment for 3 min with an interval of 0.5 min each. Subsequently, the fluorescence of 100μl from each treated lysate was measured at Ex/Em = 483/513 nm. All values were normalized to the average of the untreated control, with the resulting ratio representing the fluorescence fold change.

Figure 4. Comparison of wild-type GFPmut3b and cyclized SpyTag-GPTmut3b-SypCatcher proteins. E. coli BL21 transformed with indicated plasmid was induced using 0.3 mM IPTG at 25°C for 20 hrs. Bacterial lysates were subjected to temperatures of 90°C for 3 min. The fluorescence of 100μl lysates was measured at Ex/Em = 483/513 nm. All values were normalized to the average of the untreated control, with the resulting ratio representing the fluorescence fold change.

100°C treatment

Furthermore, the lysates were also exposed to 100°C for durations ranging from 0.5 to 3 minutes. Remarkably, GFP activity demonstrated tolerance at boiling temperatures (Figure 5), maintaining levels comparable to those observed at 90°C (Figure 3). However, there was a more pronounced loss of activity at the 0.5-minute mark. The data is consistent with Dr. Schoene’s report where β-lactamase with SpyTag at N-terminus and SpyCatcher at C-terminus exhibited resilience to boiling temperature².

Figure 5. Thermostability of cyclized SpyTag-GFPmut3b-SpyCatcher protein at 100°C. E. coli BL21 transformed with BBa_K4652002 was induced using 0.3 mM IPTG at 25°C for 20 hrs. Bacterial lysates were subjected to 100°C treatment for 3 min with an interval of 0.5 min each. The fluorescence of 100μl from each treated lysate was measured at Ex/Em = 483/513 nm. All values were normalized to the average of the untreated control, with the resulting ratio representing the fluorescence fold change.

Cyclized GFP thermal tolerance properties

In addition, we prolonged the exposure of cyclized GFP to 100°C up to 30 minutes. As shown in Figure 6, the GFP signal retained approximately 45% of its activity within the first minute, 30-35% up to 3 minutes, 20-28% up to 5 minutes, 10% at 10 minutes, and dropped below 5% after 15 minutes. These results clearly highlight the potential thermal tolerance of a synthetic cyclized protein engineered using SpyTag and SpyCatcher elements.

Figure 6. Thermal tolerance of cyclized SpyTag-GFPmut3b-SpyCatcher protein at 100°C. E. coli BL21 transformed with BBa_K4652002 was induced using 0.3 mM IPTG at 25°C for 20 hrs. Bacterial lysates were subjected to 100°C treatment for up to 30 min at the indicated time points. The fluorescence of 100μl from each treated lysate was measured at Ex/Em = 483/513 nm. All values were normalized to the average of the untreated control, with the resulting ratio representing the fluorescence fold change.

Linear Form of SpyTag-GFP-SpyCatcher Mutant

Mechanism

The mechanism for the spontaneous cyclization reaction involves Asp7 on the SpyTag at the N-terminus forming double hydrogen bonds with Glu77 on the SpyCatcher at the C-terminus. This interaction strengthens the creation of an irreversible isopeptide bond between Asp7 on SpyTag and Lys31 on SpyCatcher. As a result, the protein is seamlessly cyclized, enhancing its resistance to chemical, thermal, or enzymatic degradation³.

Plasmid construction

To investigate the impact of cyclization on protein thermostability, we created a linear version of SpyTag-GFP-SpyCatcher by introducing a mutation, substituting Asp7 with Ala7 on SpyTag, using site-directed mutagenesis by high-fidelity KOD-plus DNA polymerase with a primer sequence of 5'- AGCCCACATCGTGATGGTGGCAGCCTACAAGCCGACGAAG -3’. The mutated site was confirmed by DNA sequencing. This mutant (SpyTag (D7A)-GFP-SpyCatcher, Part:BBa_K4652001) was constructed in the same format, resulting in the expression plasmid of T7-RBS-SpyTag (D7A)-GFP-SpyCatcher-Tr (Part:BBa_K4652003).

Comparison between linear and circular form of GFP proteins

Figure 7 clearly demonstrates that the linear version fails to withstand temperatures of 90°C beyond 1 minute, even though it maintained high activity up to 0.5 minutes. Meanwhile, the cyclized GFP exhibited fluorescence intensities of around 20-30%, when exposed to 90°C or even under boiling conditions (100°C) for as long as 3 minutes. These outcomes underscore the enhanced thermal tolerance conferred by protein cyclization.

Figure 7. Thermal tolerance between cyclized and linear forms of SpyTag-GFPmut3b-SpyCatcher proteins. E. coli BL21 were transformed with BBa_K4652002 for the cyclized form and BBa_K4652003 for the linear form. After induced by 0.3 mM IPTG at 25°C for 20 hrs, the bacterial lysates were harvested and subjected to 90°C or 100°C treatment for up to 3 min at the intervals of 0.5 min. The fluorescence of 100μl from each treated lysate was measured at Ex/Em = 483/513 nm. All values were normalized to the average of the untreated control, with the resulting ratio representing the fluorescence fold change.

Protein structure of SpyTag-GFP-SpyCatcher

CONCLUSION

REFERENCE

1. Schoene C, Bennett SP, Howarth M. SpyRings Declassified: A Blueprint for Using Isopeptide-Mediated Cyclization to Enhance Enzyme Thermal Resilience. Methods Enzymol. 2016;580:149-67. doi: 10.1016/bs.mie.2016.05.004. Epub 2016 Jun 16. PMID: 27586332.
2. Schoene C, Fierer JO, Bennett SP, Howarth M. SpyTag/SpyCatcher cyclization confers resilience to boiling on a mesophilic enzyme. Angew Chem Int Ed Engl. 2014 Jun 10;53(24):6101-4. doi: 10.1002/anie.201402519. Epub 2014 May 9. PMID: 24817566; PMCID: PMC4286826.
3. Reddington SC, Howarth M. Secrets of a covalent interaction for biomaterials and biotechnology: SpyTag and SpyCatcher. Curr Opin Chem Biol. 2015 Dec;29:94-9. doi: 10.1016/j.cbpa.2015.10.002. Epub 2015 Oct 30. PMID: 26517567.

Sequence and Features