Difference between revisions of "Part:BBa K4047000"

(=Long Description)
(Long Description)
Line 18: Line 18:
  
 
===Long Description===
 
===Long Description===
This is the forward primer for transaldolase. The overlap sequence (acacaggaaacagaccatgg) allows proper Gibson assembly with the pGEM-tal backbone. The intermediate aattc sequence preserves the EcoRI restriction digest site for confirmation testing. The annealing portion (ATGGCAGCGAATTTACTCGAAC) allows annealing to the WT S. elongatus PCC 7942 genome for proper amplification.
+
This is the forward primer for transaldolase (BBa_K4047034) used to generate the pGEM-tal plasmid described in part BBa_K4047036. The overlap sequence (acacaggaaacagaccatgg) allows proper Gibson assembly with the pGEM-tal backbone. The intermediate aattc sequence preserves the EcoRI restriction digest site for confirmation testing. The annealing portion (ATGGCAGCGAATTTACTCGAAC) allows annealing to wild type Synechococcus elongatus PCC 7942 genome for proper amplification.
  
This was also the forward primer for amplification of transaldolase prior to the assembly of pGEM-tal+fbp. Once again, the overlap sequence (red) allows proper Gibson assembly with the pGEM-tal+fbp backbone. The annealing portion (all caps) allows annealing to the WT S. elongatus PCC 7942 genome for proper amplification.
+
This was also the forward primer for amplification of transaldolase prior to the assembly of pGEM-tal+fbp (BBa_K4047038). Once again, the overlap sequence allows proper Gibson assembly with the pGEM-tal+fbp backbone. The annealing portion (all caps) allows annealing to the wild type S. elongatus PCC 7942 genome for proper amplification.

Revision as of 02:06, 16 October 2021


primerT/TF_tal- forward


Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal EcoRI site found at 20
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal EcoRI site found at 20
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal EcoRI site found at 20
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal EcoRI site found at 20
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal EcoRI site found at 20
  • 1000
    COMPATIBLE WITH RFC[1000]


Long Description

This is the forward primer for transaldolase (BBa_K4047034) used to generate the pGEM-tal plasmid described in part BBa_K4047036. The overlap sequence (acacaggaaacagaccatgg) allows proper Gibson assembly with the pGEM-tal backbone. The intermediate aattc sequence preserves the EcoRI restriction digest site for confirmation testing. The annealing portion (ATGGCAGCGAATTTACTCGAAC) allows annealing to wild type Synechococcus elongatus PCC 7942 genome for proper amplification.

This was also the forward primer for amplification of transaldolase prior to the assembly of pGEM-tal+fbp (BBa_K4047038). Once again, the overlap sequence allows proper Gibson assembly with the pGEM-tal+fbp backbone. The annealing portion (all caps) allows annealing to the wild type S. elongatus PCC 7942 genome for proper amplification.