Difference between revisions of "Part:BBa K4047000"
m |
Anniequyan (Talk | contribs) (adding info) |
||
Line 1: | Line 1: | ||
− | + | This is the forward primer for transaldolase. The overlap sequence (acacaggaaacagaccatgg) allows proper Gibson assembly with the pGEM-tal backbone. The intermediate aattc sequence preserves the EcoRI restriction digest site for confirmation testing. The annealing portion (ATGGCAGCGAATTTACTCGAAC) allows annealing to the WT S. elongatus PCC 7942 genome for proper | |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + |
Revision as of 17:45, 4 October 2021
This is the forward primer for transaldolase. The overlap sequence (acacaggaaacagaccatgg) allows proper Gibson assembly with the pGEM-tal backbone. The intermediate aattc sequence preserves the EcoRI restriction digest site for confirmation testing. The annealing portion (ATGGCAGCGAATTTACTCGAAC) allows annealing to the WT S. elongatus PCC 7942 genome for proper