Difference between revisions of "Promoters/Catalog/B. subtilis/Positive"

Line 6: Line 6:
 
This section lists promoters that are recognized by [[Help:Promoters/Prokaryotic RNAP#E. coli RNA polymerases|''B. subtilis'' &sigma;<sup>A</sup> RNAP]].  &sigma;<sup>A</sup> is the major ''B. subtilis'' sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).<br>
 
This section lists promoters that are recognized by [[Help:Promoters/Prokaryotic RNAP#E. coli RNA polymerases|''B. subtilis'' &sigma;<sup>A</sup> RNAP]].  &sigma;<sup>A</sup> is the major ''B. subtilis'' sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).<br>
  
Insert table
+
<parttable>promoter_subtilis_positive_sigmaA</parttable>
  
 
==Positively regulated ''B. subtilis'' &sigma;<sup>B</sup> promoters==
 
==Positively regulated ''B. subtilis'' &sigma;<sup>B</sup> promoters==
 
This section lists promoters that are recognized by [[Help:Promoters/Prokaryotic RNAP#E. coli RNA polymerases|''B. subtilis'' &sigma;<sup>B</sup> RNAP]].  &sigma;<sup>B</sup> is the major stationary phase ''E. coli'' sigma factor.  Use these promoters when you want high promoter activity during stationary phase or during starvation.  <br>
 
This section lists promoters that are recognized by [[Help:Promoters/Prokaryotic RNAP#E. coli RNA polymerases|''B. subtilis'' &sigma;<sup>B</sup> RNAP]].  &sigma;<sup>B</sup> is the major stationary phase ''E. coli'' sigma factor.  Use these promoters when you want high promoter activity during stationary phase or during starvation.  <br>
  
Insert table
+
<parttable>promoter_subtilis_positive_sigmaB</parttable>
 +
 
 +
<html>
 +
<style>
 +
#assembly_plasmid_table {margin-left:auto;margin-right:auto; border: 3px solid #444444;}
 +
#assembly_plasmid_table td {background-color:#eeeeee; padding: 5px; font-size: 12px;}
 +
#assembly_plasmid_table th {background-color: #aaaaaa;padding: 5px; font-size:14px;}
 +
</style>
 +
</html>

Revision as of 22:14, 12 December 2008

PositivePromoter.png

All the promoters on this page are B. subtilis promoters that are positively regulated meaning that increased levels of at least one transcription factor (other than the sigma factor) will increase the activity of these promoters.

Positively regulated B. subtilis σA promoters

This section lists promoters that are recognized by B. subtilis σA RNAP. σA is the major B. subtilis sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_K090504Gram-Positive Strong Constitutive Promoter . . . acatgggaaaactgtatgtatttgatcctc2392275It's complicated

Positively regulated B. subtilis σB promoters

This section lists promoters that are recognized by B. subtilis σB RNAP. σB is the major stationary phase E. coli sigma factor. Use these promoters when you want high promoter activity during stationary phase or during starvation.


There are no parts for this table