Difference between revisions of "Promoters/Catalog/B. subtilis/Positive"
Line 6: | Line 6: | ||
This section lists promoters that are recognized by [[Help:Promoters/Prokaryotic RNAP#E. coli RNA polymerases|''B. subtilis'' σ<sup>A</sup> RNAP]]. σ<sup>A</sup> is the major ''B. subtilis'' sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).<br> | This section lists promoters that are recognized by [[Help:Promoters/Prokaryotic RNAP#E. coli RNA polymerases|''B. subtilis'' σ<sup>A</sup> RNAP]]. σ<sup>A</sup> is the major ''B. subtilis'' sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).<br> | ||
− | + | <parttable>promoter_subtilis_positive_sigmaA</parttable> | |
==Positively regulated ''B. subtilis'' σ<sup>B</sup> promoters== | ==Positively regulated ''B. subtilis'' σ<sup>B</sup> promoters== | ||
This section lists promoters that are recognized by [[Help:Promoters/Prokaryotic RNAP#E. coli RNA polymerases|''B. subtilis'' σ<sup>B</sup> RNAP]]. σ<sup>B</sup> is the major stationary phase ''E. coli'' sigma factor. Use these promoters when you want high promoter activity during stationary phase or during starvation. <br> | This section lists promoters that are recognized by [[Help:Promoters/Prokaryotic RNAP#E. coli RNA polymerases|''B. subtilis'' σ<sup>B</sup> RNAP]]. σ<sup>B</sup> is the major stationary phase ''E. coli'' sigma factor. Use these promoters when you want high promoter activity during stationary phase or during starvation. <br> | ||
− | + | <parttable>promoter_subtilis_positive_sigmaB</parttable> | |
+ | |||
+ | <html> | ||
+ | <style> | ||
+ | #assembly_plasmid_table {margin-left:auto;margin-right:auto; border: 3px solid #444444;} | ||
+ | #assembly_plasmid_table td {background-color:#eeeeee; padding: 5px; font-size: 12px;} | ||
+ | #assembly_plasmid_table th {background-color: #aaaaaa;padding: 5px; font-size:14px;} | ||
+ | </style> | ||
+ | </html> |
Revision as of 22:14, 12 December 2008
All the promoters on this page are B. subtilis promoters that are positively regulated meaning that increased levels of at least one transcription factor (other than the sigma factor) will increase the activity of these promoters.
Positively regulated B. subtilis σA promoters
This section lists promoters that are recognized by B. subtilis σA RNAP. σA is the major B. subtilis sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).
Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
---|---|---|---|---|---|---|---|
BBa_K090504 | Gram-Positive Strong Constitutive Promoter | . . . acatgggaaaactgtatgtatttgatcctc | 239 | 2275 | It's complicated |
Positively regulated B. subtilis σB promoters
This section lists promoters that are recognized by B. subtilis σB RNAP. σB is the major stationary phase E. coli sigma factor. Use these promoters when you want high promoter activity during stationary phase or during starvation.
There are no parts for this table