Difference between revisions of "Part:BBa K3050000"

Revision as of 20:24, 21 October 2019

pT7+RBS+mag-2+GFP+double_terminator

Magainin-2 expressed inside E.coli combines to cell membrane and damages it.In our project, we aimed to make BL21(DE3) lyse easier by transforming BBa_K3050000 on pSB1C3.

Usage and Biology

This is a composite part that includes T7 promotor + RBS + mag-2 + GFP + double terminators.

BBa_I746909 is linerized by Inverse PCR to be combined with magainin-2 sequense by In-Fusion reaction. https://parts.igem.org/Part:BBa_I746909

BL21(DE3) transformed pSB1C3 BBa_K3050000 successfully grew and emit strong green fluorescent light as shown in pictures. Thus we succeeded to prove Inverse PCR,In-Fusion reaction,and transformation went great.

GFP part is on downstream of T7 promotor and magainin-2, hence we're quite sure that this result indicates that magainin-2 is expressed at the same time.

Fig.1 BL21(DE3) pSB1C3 BBa_K3050000 expressed under visible light with negative control without IPTG induction

Fig.2 pSB1C3 BBa_K3050000 expressed under UV light with negative control without IPTG induction

Fig.3 Four biological replicates all highly expressed

Sequence and Features

taatacgactcactatagggagatactagagaaagaggagaaatactagaggctgttcataatttcgcccacaaacgctttgccaaattttttcgcgctatgcagaaatttgccaatgcctactagagtaatacgactcactatagggagatactagagaaagaggagaaatactagatgcgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacgacgctgacttatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatgtttacatcaccgccgataaacaaaaaaatggcattaaagcgaattttaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaacgcgatcatatggttctgctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaatgatgatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata