Difference between revisions of "Part:BBa K2332312"
Line 72: | Line 72: | ||
[[File:E-cadherin (Preproprotein BLAST).png|700px|thumb|left|'''Figure 1: BLAST Results from E-cadherin.''' | [[File:E-cadherin (Preproprotein BLAST).png|700px|thumb|left|'''Figure 1: BLAST Results from E-cadherin.''' | ||
+ | |||
[https://www.ncbi.nlm.nih.gov/Structure/cdd/cddsrv.cgi?ascbin=8&maxaln=10&seltype=2&uid=smart01055 Cadherin_pro] - Cadherin proteins are activated through cleavage of a prosequence in the late Golgi. This prevents cadherin aggregation in the early stage of the secretory pathway. This domain corresponds to the folded region of the prosequence, and is termed the prodomain. The prodomain shows structural resemblance to the cadherin domain, but lacks all the features known to be important for cadherin-cadherin interactions.. ]] | [https://www.ncbi.nlm.nih.gov/Structure/cdd/cddsrv.cgi?ascbin=8&maxaln=10&seltype=2&uid=smart01055 Cadherin_pro] - Cadherin proteins are activated through cleavage of a prosequence in the late Golgi. This prevents cadherin aggregation in the early stage of the secretory pathway. This domain corresponds to the folded region of the prosequence, and is termed the prodomain. The prodomain shows structural resemblance to the cadherin domain, but lacks all the features known to be important for cadherin-cadherin interactions.. ]] |
Revision as of 09:35, 8 October 2017
E-cadherin (Preproprotein, Mus Musculus)
E-cadherin (Preproprotein, Mus Musculus) | |
---|---|
Function | Cell-Cell Adhesion |
Use in | Mammalian cells |
Chassis Tested | Chinese Hamster Ovary (CHO) |
Abstraction Hierarchy | Part |
RFC standard | RFC10 & RFC23 compatible |
Backbone | pSB1C3 |
Submitted by | [http://2017.igem.org/Team:UCL] |
This gene encodes E-cadherin, a calcium-dependent cell adhesion molecule that functions in the establishment and maintenance of epithelial cell morphology during embryongenesis and adulthood. The encoded preproprotein undergoes proteolytic processing to generate a mature protein.
Usage and Biology
Cadherin proteins are a family of cell adhesion proteins with over 120 members.
UCSF iGEM 2011 has created a BioBrick of only the extracellular domain of E-Cadherin (Mouse) BBa_K644000 but no BioBrick encoding the full E-cadherin protein has been submitted until now. BBa_K644000 also lacked detailed characterisation and the source was imprecise. Furthermore, we know now that E-cadherin requires interaction of its cytosolic domain for the production of stable cell-cell connections. (see Alberts 6th Ed. 2015, Ch. 19, p. 1040).
This gene was given to the UCL iGEM team 2017 by Prof. Stephen Price (UCL, not part of iGEM) after we searched for cadherin proteins suitable for our project. However, no sequence was known of the plasmid we were given and we sequenced the plasmid ourselves. Consecutive BLAST analysis showed a 99% similarity with Mus musculus cadherin 1 (Cdh1), mRNA: NCBI Reference Sequence: NM_009864.3, NCBI.
Three silent mutations were added into the sequence via side directed mutagenesis in order to remove one EcoRI and two PstI sites. Afterwards we sequence confirmed the entire gene.
Experimental approach
Vector Considerations
For testing this coding part we used pcDNA3, a standard mammalian expression plasmid, as a vector. We, thereby, created BBa_K2332313, our E-cadherin gene flanked by a CMV promoter and a bGH poly(A) tail. The pre-existing 5'- and 3'-UTR and the strong promoter ensure efficient expression of E-cadherin after transfection.
Chassis Considerations
Choosing the correct chassis for your experiments is of equal importance to choosing the correct gene.
Since we wanted to test cell-cell aggregation induced by the E-cadherin gene, we therefore chose a mammalian cell line that naturally does not express E-cadherin and is commonly used in cadherin research, Chinese Hamster Ovary (CHO) cells. Even though they naturally lack E-cadherin expression they still maintain alpha- and beta-catenin expression, the two proteins that are essential for E-cadherin's connection to the actin cortex of the cell.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 2550
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 752
Illegal BamHI site found at 828
Illegal BamHI site found at 944
Illegal BamHI site found at 1868
Illegal BamHI site found at 2170
Illegal XhoI site found at 1552 - 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 208
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI site found at 65
Illegal BsaI site found at 465
Illegal BsaI site found at 872
Illegal BsaI site found at 1414
Illegal BsaI.rc site found at 306
Functional Parameters
Protein data table for BioBrick BBa_ automatically created by the BioBrick-AutoAnnotator version 1.0 | ||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Nucleotide sequence in RFC 10: (underlined part encodes the protein) AGCTTGGTACCTCCACCATGGGAGCC ... GAGGACGACTAGA ORF from nucleotide position 18 to 2669 (excluding stop-codon) | ||||||||||||||||||||||||||||||||||||||||||||||
Amino acid sequence: (RFC 25 scars in shown in bold, other sequence features underlined; both given below)
| ||||||||||||||||||||||||||||||||||||||||||||||
Sequence features: (with their position in the amino acid sequence, see the list of supported features)
| ||||||||||||||||||||||||||||||||||||||||||||||
Amino acid composition:
| ||||||||||||||||||||||||||||||||||||||||||||||
Amino acid counting
| Biochemical parameters
| |||||||||||||||||||||||||||||||||||||||||||||
Plot for hydrophobicity, charge, predicted secondary structure, solvent accessability, transmembrane helices and disulfid bridges | ||||||||||||||||||||||||||||||||||||||||||||||
Codon usage
| ||||||||||||||||||||||||||||||||||||||||||||||
Alignments (obtained from PredictProtein.org) There were no alignments for this protein in the data base. The BLAST search was initialized and should be ready in a few hours. | ||||||||||||||||||||||||||||||||||||||||||||||
Predictions (obtained from PredictProtein.org) | ||||||||||||||||||||||||||||||||||||||||||||||
There were no predictions for this protein in the data base. The prediction was initialized and should be ready in a few hours. | ||||||||||||||||||||||||||||||||||||||||||||||
The BioBrick-AutoAnnotator was created by TU-Munich 2013 iGEM team. For more information please see the documentation. If you have any questions, comments or suggestions, please leave us a comment. |