Difference between revisions of "Part:BBa K1890020"
Line 33: | Line 33: | ||
|} | |} | ||
− | To prevent annealing of the primer containing the promoter (J23100-E0840_FW) | + | To prevent annealing of the primer containing the promoter (J23100-E0840_FW) to the BioBrick prefix, a preliminary PCR was performed with a forward primer not containing the BioBrick prefix (E0840_FW) (Figure 1). |
<html> | <html> | ||
Line 45: | Line 45: | ||
<h2>Characterization</h2> | <h2>Characterization</h2> | ||
− | <p>In order to validate the fluorescence of the gene product, | + | <p>In order to validate the fluorescence of the gene product, the plasmid was expressed in <i>E. coli</i> BL21, which was grown in eM9 medium. A fluorescence spectrum was measured in a plate reader at the excitation wavelength of 488 nm. (Figure 2) </p> |
+ | |||
+ | <figure> | ||
+ | <img src="https://static.igem.org/mediawiki/2016/0/01/T--TU_Delft--Spectrum_BBa_K1890020.png" width="70%"> | ||
+ | <figcaption> | ||
+ | <b>Figure 2</b>: Fluorescence spectrum of <i>E. coli</i> BL21 expressing this part at the excitation wavelength of 488 nm. | ||
+ | </figcaption> | ||
+ | </figure> | ||
+ | |||
+ | <p>For comparison, the results were normalized by dividing by the OD600.</p> | ||
</html> | </html> |
Revision as of 19:44, 10 October 2016
GFP with strong constitutive promoter, RBS and terminator
Indroduction
Green fluorescent protein (GFP) from the jellyfish Aequorea victoria. This mutant represents a series of mutations resulting in enhanced maturation and emission [1]. It is expressed under control of the strong constitutive promoter BBa_J23100, strong RBS BBa_B0030 and terminators BBa_B0010 and BBa_B0012.
This part is based on the part BBa_E0840, with an additional promoter. This part belongs to the following part collection, consisting of GFP under five consitutive promoters with different strengths:
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 7
Illegal NheI site found at 30 - 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 700
Construction
This part is based on the part BBa_E0840, which already contains RBS, GFP gene and terminators. By means of PCR we added the strong constitutive promoter BBa_J23100. Two PCR reactions were performed with the following primers (Table 1).
Table 1: Primers used to add promoter to GFP BioBrick.
Primer name | Sequence |
---|---|
E0840_FW | ATTAAAGAGGAGAAATACTAGATGCGTAAAGG |
J23100-E0840_FW | CGGCGAATTCGCGGCCGCTTCTAGAGTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCATTAAAGAGGAGAAATACTAGATGCGTAAAGG |
VR | ATTACCGCCTTTGAGTGAGC |
To prevent annealing of the primer containing the promoter (J23100-E0840_FW) to the BioBrick prefix, a preliminary PCR was performed with a forward primer not containing the BioBrick prefix (E0840_FW) (Figure 1).
Characterization
In order to validate the fluorescence of the gene product, the plasmid was expressed in E. coli BL21, which was grown in eM9 medium. A fluorescence spectrum was measured in a plate reader at the excitation wavelength of 488 nm. (Figure 2)
For comparison, the results were normalized by dividing by the OD600.
References
[1] Cormack, B. P., Valdivia, R. H., & Falkow, S. (1996). FACS-optimized mutants of the green fluorescent protein (GFP). Gene, 173(1), 33-38.