Difference between revisions of "Part:BBa K1722005"
Line 1: Line 1:
 
__NOTOC__
 
__NOTOC__
 
<html>
 
<html>
−
 
 
<img style="width:10%" src="https://static.igem.org/mediawiki/2015/c/c9/Logo.png"/
 
<img style="width:10%" src="https://static.igem.org/mediawiki/2015/c/c9/Logo.png"/
−
 
 
</html>
 
</html>
−
 
+
{| style="color:black" cellpadding="5" cellspacing="1" border="3" align="right"
−
<partinfo>BBa_K1722005 short</partinfo>
+
! colspan="2" style="background:#d7474e;"|Rluc
 +
|-
 +
|'''Function'''
 +
|Renilla luciferase
 +
|-
 +
|'''Use in'''
 +
|E.coli%Mammalian cells
 +
|-
 +
|'''RFC standard'''
 +
|[https://parts.igem.org/Help:Assembly_standard_10 RFC 10]
 +
|-
 +
|'''Backbone'''
 +
|pSB1C3<br>
 +
|-
 +
|'''Submitted by'''
 +
|[http://2015.igem.org/Team:SZU_China SZU_China 2015]
 +
|}
 +
=====<partinfo>BBa_K1722005 short</partinfo>=====
  
 
Rluc can express Renilla luciferase which has become popular as a reporter enzyme for gene expression assays. Renilla luciferase(RLUC) is a blue-light emitting luciferase of marine anthozoan Renilla reniformis.<sup>[1]</sup> As a reporter gene, researchers attach it to a regulatory sequence of another gene of interest in bacteria, cell culture, animals or plants. RLUC is chosen as a reporter because the characteristic it confer on organisms expressing it is easily identified and measured. The bioluminescence of the sea pancy, is under the control of a nerve network<sup>[2-4]</sup> and is stimulated by changes of intracellular Ca2+ concerntration.<sup>[5-7]</sup> RLUC catalyzes the oxidation of coelenteramide, CO2 and light(480nm）,as in the following scheme:
 
Rluc can express Renilla luciferase which has become popular as a reporter enzyme for gene expression assays. Renilla luciferase(RLUC) is a blue-light emitting luciferase of marine anthozoan Renilla reniformis.<sup>[1]</sup> As a reporter gene, researchers attach it to a regulatory sequence of another gene of interest in bacteria, cell culture, animals or plants. RLUC is chosen as a reporter because the characteristic it confer on organisms expressing it is easily identified and measured. The bioluminescence of the sea pancy, is under the control of a nerve network<sup>[2-4]</sup> and is stimulated by changes of intracellular Ca2+ concerntration.<sup>[5-7]</sup> RLUC catalyzes the oxidation of coelenteramide, CO2 and light(480nm）,as in the following scheme:

Revision as of 12:20, 7 September 2015

Rluc
Function Renilla luciferase
Use in E.coli%Mammalian cells
RFC standard RFC 10
Backbone pSB1C3
Submitted by [http://2015.igem.org/Team:SZU_China SZU_China 2015]
Rluc can express Renilla luciferase（Rluc）.

Rluc can express Renilla luciferase which has become popular as a reporter enzyme for gene expression assays. Renilla luciferase(RLUC) is a blue-light emitting luciferase of marine anthozoan Renilla reniformis.[1] As a reporter gene, researchers attach it to a regulatory sequence of another gene of interest in bacteria, cell culture, animals or plants. RLUC is chosen as a reporter because the characteristic it confer on organisms expressing it is easily identified and measured. The bioluminescence of the sea pancy, is under the control of a nerve network[2-4] and is stimulated by changes of intracellular Ca2+ concerntration.[5-7] RLUC catalyzes the oxidation of coelenteramide, CO2 and light(480nm）,as in the following scheme:

The Rluc part that we submitted has one codon being amber mutated to stop codon(TAG).(Fig. 1） RLUC can only be produced when tRNA that can recognise UAG exist.

Figure 1. Sequence of Rluc

2015 SZU-iGEM construct Rlu with one codon being amber mutated and SV40, the promoter in the same plasmid to introduce Rluc into our system. This plasmid with Rluc, together with two other plasmids, are inserted into the cell. Only when the two promoters in plasmids without Rluc are activated simultanuously to express the downstream DNA sequence can Rluc being translated completely. RLUC that is produced inside the cells catalyzes a reaction with luciferin to produce light. By measuring the light intensity using Luminometer, we can tell the working efficiency of our system under different conditions.

Rlu is 936bp in length. Fig. 2 shows the DNA sequence of Rluc is successfully amplified by PCR from psi-Check2 vector. From this electrophoretogram, we can see the brightness of Rluc PCR product is rather high compared with DNA Marker, which indicates that the PCR product of Rluc is in a high concerntration.

Figure 2. Electrophoretic analysis of PCR produution of Rluc from psi-Check2.
(1:DL2000 DNA Marker 2:PCR production)
We then performed single digest(EcoRI) and double digest(EcoRI & PstI) to identify our pSB1C3-hUPll plasmid.(Fig. 3) From the eletrophoretogram, we have two electrophoresis strips at about 936bp and 2070bp, which are exactly the length of Rlu and pSB1C3, respectively in Track 1 and a strip at about 3006bp in Track 2. From this enzyme cutting result, we could make sure the Gene sequence of Rlu succeeded in being constructed into pSB1C3 vector.
Figure 3. Identification of recombinant plasmids pSB1C3-SV40-Rluc by one and two restriction enzymes.
[1:DL2000 DNA Marker 2:pSB1C3-SV40-Rluc double digest(EcoRI and PstI) 3:pSB1C3-SV40-Rluc single digest(EcoRI)]
Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 547

Design Notes

We designed the following primers and amplified Rluc promoter from the vector psi-Check2:Up: CCGGAATTCTCTAGACTGGCTGCCAAGTAGTAC Down: TGCACTGCAGACTAGTTACTGCTCGTTCTT. By incorporating these primers into Rluc promoter, the promoter is flanked by the iGEM prefix and suffix after amplification.

Source

In our experiment, we got the part from Shenzhen Second People's Hospital. Additionally, we did our system's function verification in Shenzhen Second People's Hospital.

References

[1] Jongchan W, Matthew HH, Albrecht G. Structure-function studies on the active site of the coelenterazine-dependent luciferase from Renilla, Proteinscience, 17(10): 725-735

[2] G.H. Parker, Activities of colonial animals. I. Circulation of water in Renilla, J. Exptl. Zool. 31(1920):343–367.

[3] J.A.C. Nicol, Observation on luminescence in Renilla (Pennatulacea), J. Exp. Biol. 32(1955): 299–320.

[4] P.A.V. Anderson, J.F. Case, Electrical activity associated with luminescence and other colonial behaviour in the pennatulid Renilla kollikeri, Biol. Bull. 149(1975): 80–95.

[5] M.J. Cormier, K. Hori, J.M. Anderson, Bioluminescence in coelenterates, Biochim. Biophys. Acta 346(1974):137–164.

[6] J.M. Anderson, M.J. Cormier, Lumisomes: the cellular site of bioluminescence in coelenterates, J. Biol. Chem. 248(1973):2937–2943.

[7] J.M. Anderson, H. Charbonneau, M.J. Cormier, Mechanism of calcium induction of Renilla bioluminescence. Involvement of a calcium–triggered luciferin binding protein, Biochemistry 13(1974): 1195–1200.