Difference between revisions of "Part:BBa K249019:Experience"

(→‎User Reviews)
(→‎Applications of BBa_K249019)
 
(2 intermediate revisions by the same user not shown)
Line 4: Line 4:
  
 
===Applications of BBa_K249019===
 
===Applications of BBa_K249019===
 +
One of the sub-projects for the <html><a href="http://2010.igem.org/Team:Lethbridge/Project" target="new"><font color="#00DC00"> bioremediation of the tailings ponds</font></a></html> is to reduce heavy metals to create <html><a href="http://2010.igem.org/Team:Lethbridge/Project/Magnetic_Nanoparticles" target="new"><font color="#00DC00"> magnetic nanoparticles</font></a></html> that can then be removed from the pond.  To do this we need to be able to produce Mms6 (the iron reducing protein) and show that it can successfully produce the nanoparticles within the <i>Escherichia coli</i> cell.  He is the work we have accomplished so far to characterize Mms6.
  
 
===User Reviews===
 
===User Reviews===
Line 19: Line 20:
 
<!-- DON'T DELETE --><partinfo>BBa_K249019 EndReviews</partinfo>
 
<!-- DON'T DELETE --><partinfo>BBa_K249019 EndReviews</partinfo>
  
−
When sequencing the stock we had from 2009 our team (Lethbridge) found a RBS mutation. We attempted to overexpress the protein and found that it would not. We do not know if this is the same for the kits that were sent out this year or not.  We recommend that you sequence the part before use and if it has the same mutation do not use directly but mutate the mutation out. The mutation we found is as follows:
+
===Method===
 +
In order to characterize the effect of Mms6 production on <i>Escherichia coli</i> DH5α cells, we utilized BioBrick <html><a href=" https://parts.igem.org/Part:BBa_K249019" target="new"><font color="#00DC00">BBa_K249019</font></a></html>, a part submitted by the <html><a href="http://2009.igem.org/Team:Lethbridge" target="new"><font color="#00DC00">2009 Lethbridge iGEM</font></a></html> team. <html><a href="https://parts.igem.org/Part: BBa_K249019" target="new"><font color="#00DC00">BBa_K249019</font></a></html> is the Mms6 coding region (<html><a href="https://parts.igem.org/Part: BBa_K249016" target="new"><font color="#00DC00">BBa_K249016</font></a></html>) with a ribosomal binding side (<html><a href="https://parts.igem.org/Part: BBa_B0030" target="new"><font color="#00DC00">BBa_B0030</font></a></html>) and a double terminator (<html><a href="https://parts.igem.org/Part: BBa_B0015" target="new"><font color="#00DC00">BBa_B0015</font></a></html>) under the control of a lactose inducible promoter (<html><a href="BBa_R0010" target="new"><font color="#00DC00"> BBa_R0010</font></a></html>).  
 +
<br><br>
 +
We inoculated two 500 mL cultures of LB media with <i>Escherichia coli</i> DH5α cells containing <html><a href="https://parts.igem.org/Part: BBa_K249019" target="new"><font color="#00DC00">BBa_K249019</font></a></html> and grew the cells until they reached approximately 0.6 OD<sub>600</sub> units. At this point, expression of the Mms6 protein was induced in one of the 500 mL cultures by the addition of 1 mM Isopropyl β-D-1-thiogalactopyranoside (IPTG). One milliliter of cells from each sample was removed at one hour intervals and the optical density at 600 nm was recorded and plotted.
 +
<br><br>
  
−
              Mms6 7 VF Prefix  TCCCGACTGGAAAGCGGG-NNANAGNGCAACGCAATTAATGTGAGTTAGCTCACTCATTA
+
===Results===
−
Mms6 7 VR A-Suffix (reversed)  TCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTA
+
The addition of IPTG to cells containing the <html><a href="https://parts.igem.org/Part: BBa_K249019" target="new"><font color="#00DC00">BBa_K249019</font></a></html> BioBrick caused a slowdown of cell growth after 2 hours, and a subsequent plateau at approximately one-half of the cells density that uninduced cells reached after three hours post-induction.
−
              Mms6 8 VF Prefix  TCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTA
+
<br>
−
Mms6 8 VR A-Suffix (reversed)   TCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTA
+
[[image:UofLmms6growth.jpg|450px|center]]
−
                          mRBS  TCAC-ACAGGAAAG----------------------------------------------
+
<br>
 +
 
 +
===Conclusion===
 +
The slowdown in cell growth as a result of production of Mms6 protein could be attributed to a number of factors.
 +
<br><br>
 +
One potential explanation could be a significant diversion of cellular resources to the production of Mms6 protein. This is unlikely, as subsequent analysis of cell fractions with SDS-PAGE showed no increase in banding at the expected molecular weight.
 +
<br><br>
 +
Another explanation could be that the Mms6 protein is toxic to the cells, and causes them to die. This possibility is being explored in collaboration with the <html><a href=" http://2010.igem.org/Team:Calgary" target="new"><font color="#00DC00">Calgary team</font></a></html> by using their troubleshooting kit.
 +
<br><br>
 +
===References===
 +
<sup>1</sup>Arakaki A., Masuda F., Amemiya Y., Tanaka T., Matsunaga T. (2010). Control of the morphology and size of magnetite particles with peptides mimicking the Mms6 protein from magnetotactic bacteria. <i>Journal of Colloid and Interface Science</i>. 343:65-60.

Latest revision as of 22:27, 27 October 2010

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

Applications of BBa_K249019

One of the sub-projects for the bioremediation of the tailings ponds is to reduce heavy metals to create magnetic nanoparticles that can then be removed from the pond. To do this we need to be able to produce Mms6 (the iron reducing protein) and show that it can successfully produce the nanoparticles within the Escherichia coli cell. He is the work we have accomplished so far to characterize Mms6.

User Reviews

UNIQ7c33e1b0bb5f5c72-partinfo-00000002-QINU UNIQ7c33e1b0bb5f5c72-partinfo-00000003-QINU

Method

In order to characterize the effect of Mms6 production on Escherichia coli DH5α cells, we utilized BioBrick BBa_K249019, a part submitted by the 2009 Lethbridge iGEM team. BBa_K249019 is the Mms6 coding region (BBa_K249016) with a ribosomal binding side (BBa_B0030) and a double terminator (BBa_B0015) under the control of a lactose inducible promoter ( BBa_R0010).

We inoculated two 500 mL cultures of LB media with Escherichia coli DH5α cells containing BBa_K249019 and grew the cells until they reached approximately 0.6 OD600 units. At this point, expression of the Mms6 protein was induced in one of the 500 mL cultures by the addition of 1 mM Isopropyl β-D-1-thiogalactopyranoside (IPTG). One milliliter of cells from each sample was removed at one hour intervals and the optical density at 600 nm was recorded and plotted.

Results

The addition of IPTG to cells containing the BBa_K249019 BioBrick caused a slowdown of cell growth after 2 hours, and a subsequent plateau at approximately one-half of the cells density that uninduced cells reached after three hours post-induction.

450px


Conclusion

The slowdown in cell growth as a result of production of Mms6 protein could be attributed to a number of factors.

One potential explanation could be a significant diversion of cellular resources to the production of Mms6 protein. This is unlikely, as subsequent analysis of cell fractions with SDS-PAGE showed no increase in banding at the expected molecular weight.

Another explanation could be that the Mms6 protein is toxic to the cells, and causes them to die. This possibility is being explored in collaboration with the Calgary team by using their troubleshooting kit.

References

1Arakaki A., Masuda F., Amemiya Y., Tanaka T., Matsunaga T. (2010). Control of the morphology and size of magnetite particles with peptides mimicking the Mms6 protein from magnetotactic bacteria. Journal of Colloid and Interface Science. 343:65-60.