Difference between revisions of "Part:BBa K5317011"

(→‎CuSO4 stimulation)
 
(2 intermediate revisions by 2 users not shown)
Line 96: Line 96:
 
</html>
 
</html>
  
−
Figure 2: HEK293T cells single-transfected with the MREdada-EGFP-C2 plasmid exhibited no EGFP-signal under unstimulated condiotions. Scale bar = 20 µm.
+
Figure 2: HEK293T cells single-transfected with the MREdada-EGFP-C2 plasmid exhibited no EGFP-signal under unstimulated conditions. Scale bar = 20 µm.
  
−
The single transfection with the MREdada-EGFP-C2 plasmid in HEK293T cells showed no base signal without the co-transfection with the CMV-MTF1-mRuby2 plasmid and no metal ion stimulation. The experiments allow conclusions about sensitivity and specificity of the promoter under homeostatic conditions. In conclusion, the generated promoter has no unspecific expression by for example other, under homeostatic conditions active, transcription factors. The possible endogenous expression of MTF-1 is also not enough to generate a fluorescent signal under unstimulated conditons.
+
The single transfection with the MREdada-EGFP-C2 plasmid in HEK293T cells showed no base signal without the co-transfection with the CMV-MTF1-mRuby2 plasmid and no metal ion stimulation. The experiments allow conclusions about the sensitivity and specificity of the promoter under homeostatic conditions. In conclusion, the generated promoter has no unspecific expression by for example other, under homeostatic conditions active, transcription factors. The possible endogenous expression of MTF-1 is also not enough to generate a fluorescent signal under unstimulated conditions.
  
 
===Co-transfection experiments with MTF-1===
 
===Co-transfection experiments with MTF-1===
  
−
To convert the presence of metal ions into a fluorescent signal, the co-transfection of the metal ion sensor protein MTF-1, which can then bind to second induced plasmid, carrying the MREdada promoter, enables a signaling cascade resulting in the expression of EGFP. The successful double-transfection of as many cells as possible, in addition to the non- or only MREdada-EGFP-C2- or only MTF1-mRuby2-C2- transfected cells, is crucial for sensor functionality.  
+
To convert the presence of metal ions into a fluorescent signal, the co-transfection of the metal ion sensor protein MTF-1, which can then bind to the second induced plasmid, carrying the MREdada promoter, enables a signaling cascade resulting in the expression of EGFP. The successful double-transfection of as many cells as possible, in addition to the non- or only MREdada-EGFP-C2- or only MTF1-mRuby2-C2- transfected cells, is crucial for sensor functionality.  
−
Figure 3 clearly shows that some of the HEK293T cells successfully display both mRuby2 and EGFP signals intracellularly. The mRuby2 signal, which reflects the localisation of MTF1, shows a nuclear signal, whereas the EGFP shows a cytoplasmic signal as expected.  
+
Figure 3 clearly shows that some of the HEK293T cells successfully display both mRuby2 and EGFP signals intracellularly. The mRuby2 signal, which reflects the localization of MTF1, shows a nuclear signal, whereas the EGFP shows a cytoplasmic signal as expected.  
  
 
<html>
 
<html>
Line 112: Line 112:
 
</html>
 
</html>
  
−
Figure 3: Representative microscopy images of HEK293T cells co-transfected with MTF-1-mRuby2-C2 toghether with the MREdada-EGFP-C2 plasmid under homeostatic conditions. The mRuby2 signal from MTF-1 is localized in the nucleus while the EGFP signal is cytoplasmically distributed. Shown are brightfield channels (left), fluorescence channels (images in the center) and an overlay of the channels (right).
+
Figure 3: Representative microscopy images of HEK293T cells co-transfected with MTF-1-mRuby2-C2 together with the MREdada-EGFP-C2 plasmid under homeostatic conditions. The mRuby2 signal from MTF-1 is localized in the nucleus while the EGFP signal is cytoplasmically distributed. Shown are brightfield channels (left), fluorescence channels (images in the center), and an overlay of the channels (right).
  
−
A basal expression of the promoter-driven reporter fluorophore EGFP can be seen for without metal stimulation. This is due to possible metal ions in the culture medium of the HEK293T cells that could interact with the MTF-1.
+
A basal expression of the promoter-driven reporter fluorophore EGFP can be seen without metal stimulation. This is due to possible metal ions in the culture medium of the HEK293T cells that could interact with the MTF-1.
  
 
====CuSO<sub>4</sub> stimulation====
 
====CuSO<sub>4</sub> stimulation====
Line 137: Line 137:
 
<html>
 
<html>
 
<center>
 
<center>
−
<img src="https://static.igem.wiki/teams/5317/registry/k5317011-facs.png" style="width: 60%; height: 60%">
+
<img src="https://static.igem.wiki/teams/5317/registry/k5317011-quantification.png" style="width: 60%; height: 60%">
 
</p>
 
</p>
 
</center>
 
</center>
 
</html>
 
</html>
  
−
Figure 5: Quantitive validation by flow cytometry analysis. The percentage of cells expressing the fluorophore EGFP under the control of the MREdada promoter is displayed as a function of various concentrations of copper sulfate incubated for four hours. The cells were pregated on the basis of their mRuby2-positivity. n=1.
+
Figure 5: Quantitive validation by flow cytometry analysis. The percentage of cells expressing the fluorophore EGFP under the control of the MREdada promoter is displayed as a function of various concentrations of copper sulfate incubated for four hours. The cells were pregated based on their mRuby2-positivity. n=1.
  
−
Although not continuous, a clear increase in the number of EGFP-expressing cells can be recognised with increasing copper sulphate concentration in the medium. Growing from approx. 11.5 % to approx. 16.4 % of EGFP-positive cells under stimulation with 0 µM or 500 µM CuSO4, respectively.  
+
Although not continuous, a clear increase in the number of EGFP-expressing cells can be recognized with increasing copper sulphate concentration in the medium. Growing from approx. 11.5 % to approx. 16.4 % of EGFP-positive cells under stimulation with 0 µM or 500 µM CuSO<sub>4</sub>, respectively.  
−
Even if complicated by high basal activity, the presence of copper sulphate can be detected with the MREdada promoter construct and the MREdada promoter designed by our group showed a better response to copper sulphate that the MREwt promoter.
+
Even if complicated by high basal activity, the presence of copper sulphate can be detected with the MREdada promoter construct and the MREdada promoter designed by our group showed a better response to copper sulphate than the MREwt promoter.
 
However, it should be noted that the experiment could only be carried out once due to time constraints.
 
However, it should be noted that the experiment could only be carried out once due to time constraints.
  

Latest revision as of 21:56, 1 October 2024


MREdada-EGFP

Usage and Biology

The MRE-sites containing promoter enables the metal-dependent expression of the downstream positioned reporter gene EGFP via the metal ion-dependent transcription factor MTF-1 for cell-based metal detection.

In order to integrate the findings of Searle and colleagues (1985) and Wang and colleagues (2004) regarding the metal inducibility of a promoter with two MREa sites and a high affinity between MREd and MTF-1, we designed a synthetic promoter with two MREa and two MREd sites that alternate. The aim is to enhance the sensitivity and efficiency of the metal-dependent promoter.

Cloning

Theoretical Part Design

Placing the MREdada promoter upstream of the reporter gene EGFP allows the visualization of primarily metal-dependent activation of MTF-1.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]

Cloning

To test the MREdada promoter functionality the reporter gene EGFP (K3338006) was cloned downstream of the promoter by inserting the MREdada promoter into the AseI- and NheI-digested EGFP-C2 backbone (K3338020) using NEB Hifi Assembly.

HTML Table Caption Table1: Primers used to create matching overhangs on promoter amplicon to digested pEGFP-C2 backbone

Primer name Sequence
MREdada_fw CCGCCATGCATTAGTTATGCACACTGGCGCT
MREdada_rev TGGCGACCGGTAGCGGACGCTTAGAGGACAGC
The vector map of the assembled construct is shown in figure 1.

Figure 1: The vector map depicts the integration of the MREdada promoter into the pEGFP-C2 backbone, placing it upstream of the reporter gene EGFP.

Characterization

Transfection experiments in mammalian HEK293T cells assessed the promoter functionality and sensitivity. First, the composite part carrying plasmid was introduced via transfection to establish a baseline of endogenous promoter activity before performing co-transfection experiments with the CMV-MTF-1-mRuby2 carrying plasmid (composite part K5317012) under varying copper concentration for stimulation. The EGFP fluorescence signal was analyzed for localization by microscopy and intensity by FACS analysis.

Single-transfection experiments

Figure 2: HEK293T cells single-transfected with the MREdada-EGFP-C2 plasmid exhibited no EGFP-signal under unstimulated conditions. Scale bar = 20 µm.

The single transfection with the MREdada-EGFP-C2 plasmid in HEK293T cells showed no base signal without the co-transfection with the CMV-MTF1-mRuby2 plasmid and no metal ion stimulation. The experiments allow conclusions about the sensitivity and specificity of the promoter under homeostatic conditions. In conclusion, the generated promoter has no unspecific expression by for example other, under homeostatic conditions active, transcription factors. The possible endogenous expression of MTF-1 is also not enough to generate a fluorescent signal under unstimulated conditions.

Co-transfection experiments with MTF-1

To convert the presence of metal ions into a fluorescent signal, the co-transfection of the metal ion sensor protein MTF-1, which can then bind to the second induced plasmid, carrying the MREdada promoter, enables a signaling cascade resulting in the expression of EGFP. The successful double-transfection of as many cells as possible, in addition to the non- or only MREdada-EGFP-C2- or only MTF1-mRuby2-C2- transfected cells, is crucial for sensor functionality. Figure 3 clearly shows that some of the HEK293T cells successfully display both mRuby2 and EGFP signals intracellularly. The mRuby2 signal, which reflects the localization of MTF1, shows a nuclear signal, whereas the EGFP shows a cytoplasmic signal as expected.

Figure 3: Representative microscopy images of HEK293T cells co-transfected with MTF-1-mRuby2-C2 together with the MREdada-EGFP-C2 plasmid under homeostatic conditions. The mRuby2 signal from MTF-1 is localized in the nucleus while the EGFP signal is cytoplasmically distributed. Shown are brightfield channels (left), fluorescence channels (images in the center), and an overlay of the channels (right).

A basal expression of the promoter-driven reporter fluorophore EGFP can be seen without metal stimulation. This is due to possible metal ions in the culture medium of the HEK293T cells that could interact with the MTF-1.

CuSO4 stimulation

With MREwt-EGFP-C2 and MTF1-mRuby2-C2 double transfected HEK293T cells were exposed to 500 µM CuSO4 for four hours in order to test the responsiveness of the sensor to metal ions.

Figure 4: Representative microscopy images of HEK293T cells co-transfected with MTF-1-mRuby2 and the MREdada-EGFP-C2 plasmid before (left column) and after (right column) stimulation with 500 µM CuSO4 for four hours.

Unfortunately, no clear visual increase in fluorescence was detected for these promoters compared to the baseline signal. However, it is important to note that only small sample sections are presented here, and transfection efficiency may vary between treatments. Visual assessment of fluorescence changes is challenging, which is why flow cell cytometry was subsequently considered to obtain a quantitative analysis.

FACS analysis

FACS analysis enables the quantification of fluorescence signals, which is why they were used here to evaluate the increase in EGFP-positive cells in MTF1-mRuby2-C2 and MREdada-EGFP-C2 double-transfected cells depending on the copper sulphate concentration added to the medium for four hours. The results are presented in the bar chart in figure 5.

Figure 5: Quantitive validation by flow cytometry analysis. The percentage of cells expressing the fluorophore EGFP under the control of the MREdada promoter is displayed as a function of various concentrations of copper sulfate incubated for four hours. The cells were pregated based on their mRuby2-positivity. n=1.

Although not continuous, a clear increase in the number of EGFP-expressing cells can be recognized with increasing copper sulphate concentration in the medium. Growing from approx. 11.5 % to approx. 16.4 % of EGFP-positive cells under stimulation with 0 µM or 500 µM CuSO4, respectively. Even if complicated by high basal activity, the presence of copper sulphate can be detected with the MREdada promoter construct and the MREdada promoter designed by our group showed a better response to copper sulphate than the MREwt promoter. However, it should be noted that the experiment could only be carried out once due to time constraints.

Reference

Searle, P. F., Stuart, G. W., & Palmiter, R. D. (1985). Building a metal-responsive promoter with synthetic regulatory elements. Molecular and cellular biology, 5(6), 1480–1489. https://doi.org/10.1128/mcb.5.6.1480-1489.1985

Wang, Y., Lorenzi, I., Georgiev, O., & Schaffner, W. (2004). Metal-responsive transcription factor-1 (MTF-1) selects different types of metal response elements at low vs. high zinc concentration. Biological chemistry, 385(7), 623–632. https://doi.org/10.1515/BC.2004.077