Difference between revisions of "Part:BBa K5317020"

(→‎Functional Parameters)
(→‎Usage and Biology)
 
(21 intermediate revisions by 2 users not shown)
Line 5: Line 5:
 
===Usage and Biology===
 
===Usage and Biology===
  
−
Contained within are two key genes: mRuby2, a red fluorescent protein for live-cell imaging, and graR, a regulator that might bind to PknB upon phosphorylating GraR. . GraR is known for its role in β-lactam resistance by upregulating cell wall biosynthesis genes, altering cell wall composition, and increasing expression of ABC-transporter (El-Halfawy ''et al.'', 2020),(Yang ''et al.'', 2012),(Meehl ''et al.'', 2007). The GraSR system is a two-component regulatory system that controls the expression of many genes involved in stress response, cell wall metabolism and virulence pathways. The GraSR system was found to control genes involved in stress response, cell wall metabolism and virulence pathways, in addition to playing an important role in CAMP resistance, thus greatly enhancing its importance as the main signal transduction pathway of Staphylococcus aureus (Falord ''et al.'', 2011). When activated by pknB, GraR binds to specific DNA sequences to regulate gene expression, in our case it presumably binds to a specific engineered promotor.  
+
Integrated into the CMV-GraR-mRuby2 cassette are two key genes next to the constitutively active CMV promoter: mRuby2, a red fluorescent protein for live-cell imaging, and GraR, a regulator that might bind to the PknB-kinase upon detecting beta-lactams and gets activated by phosphorylation. GraR is known for its role in β-lactam resistance by upregulating cell wall biosynthesis genes, altering cell wall composition, and increasing expression of ABC-transporter (El-Halfawy ''et al.'', 2020),(Yang ''et al.'', 2012),(Meehl ''et al.'', 2007). The GraSR system was found to control genes involved in stress response, cell wall metabolism, and virulence pathways, in addition to playing an important role in CAMP resistance (Falord ''et al.'', 2011).
 +
 
 +
Our aim was its utilization as a signal transmitter in our cell-based antibiotic sensor. When phosphorylated by the detection unit PknB (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317013 K5317013]</span>), GraR translocates into the nucleus and binds to specific DNA sequences in our engineered 3xCre3xAP1-miniCMV promoter (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317017 K5317017]</span>), leading to the expression of the downstream located miRFP670 (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317002 K5317002]</span>).
  
 
=Cloning=
 
=Cloning=
−
This  part was engineered with NEBBuilder® HIFI assembly method. First the backbone was linearized with NheI and BamHI and matching ends of gene and backbone ensured seamless cloning of GraR. In mammalian systems, this part is useful for studying the potential interactions between GraR and PknB.
+
 
−
<!-- -->
+
===Theoretical Part Design===
−
<span class='h3bb'>Sequence and Features</span>
+
The GraR sequence (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317015 K5317015]</span>) was codon-optimized for mammalian expression systems and synthesized before fusing the mRuby2 fluorescent marker (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317001 K5317001]</span>) C-terminally to visualize localisation of GraR when stimulated with ß-lactam antibiotics. To ensure a constitutive expression of the transcription factor, the CMV of the pEGFP-C2 backbone was utilized.
 +
 
 +
===Sequence and features===
 +
 
 
<partinfo>BBa_K5317020 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K5317020 SequenceAndFeatures</partinfo>
  
−
===References==
+
===Cloning===
 +
This part was engineered with NEBBuilder® HIFI assembly method. First, the backbone was linearized with NheI and BamHI, creating matching approx. 20 bp-long overhangs between both inserts and the backbone ensuring the correct order of CMV-GraR-mRuby2. In mammalian systems, we used this plasmid to study the potential interactions between GraR and PknB. The inserts were amplified by using the primers in table 1.
 +
 
 +
<html>
 +
 
 +
 +
 
 +
  <head>
 +
 
 +
      <title>HTML Table Caption</title>
 +
 
 +
  </head>
 +
 
 +
 +
 
 +
<body>
 +
 
 +
<caption>Table1: Primers used to extract the GraR gene sequence.</caption>
 +
 
 +
<table style="width:70%">
 +
 
 +
  <tr>
 +
 
 +
    <th>Primer name</th>
 +
 
 +
    <th>Sequence</th>
 +
 
 +
  </tr>
 +
 
 +
  <tr>
 +
 
 +
    <td>GraR_fw</td>
 +
 
 +
    <td>TGAACCGTCAGATCCGatgcaaatactactagtagaagatgacaatactttgt</td>
 +
 
 +
  </tr>
 +
 
 +
  <tr>
 +
 
 +
    <td>GraR_rev</td>
 +
 
 +
    <td>tggatccccttcatgagccatatatccttttcctacttttgt</td>
 +
</tr>
 +
 
 +
  <tr>
 +
 
 +
    <td>mRuby2_fw</td>
 +
 
 +
    <td>tggatccccttcatgagccatatatccttttcctacttttgt</td>
 +
 
 +
  </tr>
 +
 
 +
  <tr>
 +
 
 +
    <td>mRuby2_rev</td>
 +
 
 +
    <td>TCAGTTATCTAGATCCGGTGttacttgtacagctcgtccatcccacc</td>
 +
 
 +
 
 +
  </tr>
 +
 
 +
</table>
 +
 
 +
</body>
 +
 +
 
 +
 +
 
 +
</html>
 +
 
 +
<html>
 +
<center>
 +
<img src="https://static.igem.wiki/teams/5317/grar-mrubx2.png" style="width: 50%; height: 50%">
 +
</p>
 +
</center>
 +
</html>
 +
 
 +
Figure 1: Assembled vector map with GraR-mRuby2 integrated into the pEGFP-C2 backbone.
 +
 
 +
=Characterisation=
 +
Transfection experiments were conducted of CMV-GraR-mRuby2 in mammalian HEK293T cells to show successful expression and localization of GraR under unstimulated conditions.
 +
 
 +
===Single-transfection experiments===
 +
 
 +
<html>
 +
<center>
 +
<img src="https://static.igem.wiki/teams/5317/grar-bba-k5317020-2.png" style="width: 70%; height: 70%">
 +
</p>
 +
</center>
 +
</html>
 +
 
 +
Figure 2: Single-transfected HEK293T cells with the CMV-graR-mRuby2 plasmid depicted low mRuby2-signal under unstimulated conditions. Scale bar = 20 µm.
 +
 
 +
The representative images of figure 2 depict HEK293T cells after transfection with CMV-GraR-mRuby2. Even under unstimulated conditions, the HEK293T cells emitted low mRuby2 fluorescent signals, indicating a successful codon optimization and transfection. No further experiments were performed using this transcription factor since the intracellular assembly of all sensor parts was performed using the transcription factor ATF2 (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317016 K5317016]</span>) as the signal transmitter.
 +
 
 +
=References=
  
 
El-Halfawy, O. M., Czarny, T. L., Flannagan, R. S., Day, J., Bozelli, J. C., Kuiack, R. C., Salim, A., Eckert, P., Epand, R. M., McGavin, M. J., Organ, M. G., Heinrichs, D. E., & Brown, E. D. (2020). Discovery of an antivirulence compound that reverses β-lactam resistance in MRSA. ''Nature Chemical Biology'', 16(2), 143–149. https://doi.org/10.1038/s41589-019-0401-8
 
El-Halfawy, O. M., Czarny, T. L., Flannagan, R. S., Day, J., Bozelli, J. C., Kuiack, R. C., Salim, A., Eckert, P., Epand, R. M., McGavin, M. J., Organ, M. G., Heinrichs, D. E., & Brown, E. D. (2020). Discovery of an antivirulence compound that reverses β-lactam resistance in MRSA. ''Nature Chemical Biology'', 16(2), 143–149. https://doi.org/10.1038/s41589-019-0401-8

Latest revision as of 21:04, 1 October 2024


CMV-GraR-mRuby2

Usage and Biology

Integrated into the CMV-GraR-mRuby2 cassette are two key genes next to the constitutively active CMV promoter: mRuby2, a red fluorescent protein for live-cell imaging, and GraR, a regulator that might bind to the PknB-kinase upon detecting beta-lactams and gets activated by phosphorylation. GraR is known for its role in β-lactam resistance by upregulating cell wall biosynthesis genes, altering cell wall composition, and increasing expression of ABC-transporter (El-Halfawy et al., 2020),(Yang et al., 2012),(Meehl et al., 2007). The GraSR system was found to control genes involved in stress response, cell wall metabolism, and virulence pathways, in addition to playing an important role in CAMP resistance (Falord et al., 2011).

Our aim was its utilization as a signal transmitter in our cell-based antibiotic sensor. When phosphorylated by the detection unit PknB (K5317013), GraR translocates into the nucleus and binds to specific DNA sequences in our engineered 3xCre3xAP1-miniCMV promoter (K5317017), leading to the expression of the downstream located miRFP670 (K5317002).

Cloning

Theoretical Part Design

The GraR sequence (K5317015) was codon-optimized for mammalian expression systems and synthesized before fusing the mRuby2 fluorescent marker (K5317001) C-terminally to visualize localisation of GraR when stimulated with ß-lactam antibiotics. To ensure a constitutive expression of the transcription factor, the CMV of the pEGFP-C2 backbone was utilized.

Sequence and features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal XbaI site found at 889
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal XbaI site found at 889
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal XbaI site found at 889
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal SapI.rc site found at 1342

Cloning

This part was engineered with NEBBuilder® HIFI assembly method. First, the backbone was linearized with NheI and BamHI, creating matching approx. 20 bp-long overhangs between both inserts and the backbone ensuring the correct order of CMV-GraR-mRuby2. In mammalian systems, we used this plasmid to study the potential interactions between GraR and PknB. The inserts were amplified by using the primers in table 1.

HTML Table Caption Table1: Primers used to extract the GraR gene sequence.

Primer name Sequence
GraR_fw TGAACCGTCAGATCCGatgcaaatactactagtagaagatgacaatactttgt
GraR_rev tggatccccttcatgagccatatatccttttcctacttttgt
mRuby2_fw tggatccccttcatgagccatatatccttttcctacttttgt
mRuby2_rev TCAGTTATCTAGATCCGGTGttacttgtacagctcgtccatcccacc

Figure 1: Assembled vector map with GraR-mRuby2 integrated into the pEGFP-C2 backbone.

Characterisation

Transfection experiments were conducted of CMV-GraR-mRuby2 in mammalian HEK293T cells to show successful expression and localization of GraR under unstimulated conditions.

Single-transfection experiments

Figure 2: Single-transfected HEK293T cells with the CMV-graR-mRuby2 plasmid depicted low mRuby2-signal under unstimulated conditions. Scale bar = 20 µm.

The representative images of figure 2 depict HEK293T cells after transfection with CMV-GraR-mRuby2. Even under unstimulated conditions, the HEK293T cells emitted low mRuby2 fluorescent signals, indicating a successful codon optimization and transfection. No further experiments were performed using this transcription factor since the intracellular assembly of all sensor parts was performed using the transcription factor ATF2 (K5317016) as the signal transmitter.

References

El-Halfawy, O. M., Czarny, T. L., Flannagan, R. S., Day, J., Bozelli, J. C., Kuiack, R. C., Salim, A., Eckert, P., Epand, R. M., McGavin, M. J., Organ, M. G., Heinrichs, D. E., & Brown, E. D. (2020). Discovery of an antivirulence compound that reverses β-lactam resistance in MRSA. Nature Chemical Biology, 16(2), 143–149. https://doi.org/10.1038/s41589-019-0401-8

Falord, M., Mäder, U., Hiron, A., Débarbouillé, M., & Msadek, T. (2011). Investigation of the Staphylococcus aureus GraSR Regulon Reveals Novel Links to Virulence, Stress Response and Cell Wall Signal Transduction Pathways. PLoS ONE, 6(7), e21323. https://doi.org/10.1371/journal.pone.0021323

Meehl, M., Herbert, S., Götz, F., & Cheung, A. (2007). Interaction of the GraRS Two-Component System with the VraFG ABC Transporter To Support Vancomycin-Intermediate Resistance in Staphylococcus aureus. Antimicrobial Agents and Chemotherapy, 51(8), 2679–2689. https://doi.org/10.1128/AAC.00209-07

Yang, S.-J., Bayer, A. S., Mishra, N. N., Meehl, M., Ledala, N., Yeaman, M. R., Xiong, Y. Q., & Cheung, A. L. (2012). The Staphylococcus aureus Two-Component Regulatory System, GraRS, Senses and Confers Resistance to Selected Cationic Antimicrobial Peptides. Infection and Immunity, 80(1), 74–81. https://doi.org/10.1128/IAI.05669-11