Difference between revisions of "Part:BBa K5107008"
 
(5 intermediate revisions by the same user not shown)
Line 3: Line 3:
 
<partinfo>BBa_K5107008 short</partinfo>
 
<partinfo>BBa_K5107008 short</partinfo>
  
−
we can do it later
+
T7-EREminimal-sB-T is a construct used in the cell free biosensor.The EREmininimal is recognised by the steroid estrogen hormone receptor. Through this interaction, the in vitro transcription of a monomeric broccoli aptamer is controlled based on the presence of EDCs.
  
 +
===Usage and Biology===
 +
For the structure of the biosensor, we took inspiration from the ROSALIND cell-free biosensor<html><a href="#ref1">[1]</a></html>, modifying their design to match our goals. We kept the general idea of having a Transcription Factor (TF) altering the activity of a RNA polymerase, and the output signal as a consequence. We tailored the ROSALIND concept by selecting specific custom transcription factors (TFs) as receptors and designing unique operator sequences to serve as responsive elements.
  
 +
==Cell free biosensor==
 +
This is the principal function of our desinged biosensor
 +
<html>
 +
<center>
 +
    <div style="display: flex; justify-content: center;">
 +
        <figure>
 +
            <img src="https://static.igem.wiki/teams/5107/eng-cellfreesystem-p1.webp" height="300" alt="Cell-Free System Part 1">
 +
            <figcaption><b>Figure 1:</b> Cell-Free System - No Hormone/EDC in the environment.</figcaption>
 +
        </figure>
 +
        <figure style="margin-left: 20px;">
 +
            <img src="https://static.igem.wiki/teams/5107/eng-cellfreesystem-p2.webp" height="300" alt="Cell-Free System Part 2">
 +
            <figcaption><b>Figure 2:</b> Cell-Free System - Hormone/EDC in the environment.</figcaption>
 +
        </figure>
 +
    </div>
 +
</center>
 +
</html>
 +
'''When no EDC is present'''(Figure 1), the receptor will not bind the DNA, and thus the T7 RNAP is free to interact with the promoter, and transcribe the Broccoli aptamer. Once produced, the aptamer binds to the DFHBI-1T fluorophore, and enables fluorescence, by absorbing light at 472 nm and emitting it at 507 nm.
 +
'''When an EDC is present'''(Figure 2), it will bind the hormone receptor and induce a conformational change that will allow it to bind the receptor response element. Once the receptor is bound to the DNA, it will act as a repressor, suppressing the transcription from the T7 RNA promoter.
  
−
===Usage and Biology===
+
==Assembly==
 +
 
 +
{| class="wikitable"
 +
|+ Human Receptor Information
 +
|-
 +
! Human Receptor !! Response Element (Operator Site) !! Natural Hormone !! Plasmid Name (In-Cell System)
 +
|-
 +
| Estrogen Receptor α (ERα) || ERE || 17β-Estradiol || pRR-ERalpha-5Z
 +
|-
 +
| Estrogen Receptor β (ERβ) || ERE || 17β-Estradiol || pRR-ERbeta-5Z
 +
|-
 +
| Glucocorticoid Receptor (GR) || HRE || Dexamethasone || pRR-GR-5Z
 +
|-
 +
| Androgen Receptor (AR) || HRE || Testosterone || pRR-AR-5Z
 +
|-
 +
| Mineralocorticoid Receptor (MR) || HRE || Aldosterone || pRR-MR-5Z
 +
|-
 +
| Progesterone Receptor (PR) || HRE || Progesterone || pRR-PR-5Z
 +
|}
 +
''Table 1: Human Receptor Information''
 +
 
 +
 
 +
 
 +
We designed DNA templates using two response elements: ERE and HRE, designed to interact with the above-listed receptors (see Table 1 for details). We designed versions with only a single response element and only a single repeat. For its minimalistic approach, we denoted these parts <strong>EREminimal:</strong>[https://parts.igem.org/Part:BBa_K5107001 BBa_K5107001] and <strong> HREminimal:</strong>[https://parts.igem.org/Part:BBa_K5107000 BBa_K5107000].
 +
 
 +
{| class="wikitable"
 +
|+ Minimal Response Elements
 +
|-
 +
! Element !! Sequence
 +
|-
 +
| EREminimal || '''CCAGGTCAGAGTGACCTG'''
 +
|-
 +
| HREminimal || '''AGAACAGAGTGTTCT'''
 +
|}
 +
''Table 2: Minimal Response Elements''
 +
 
 +
 
 +
*Design - Generating a measurable readout
 +
 
 +
As for the output, we decided to go for a less tedious reporter than the one previously used. For our cell-free system, the simplest and fastest way to have an output is to use an aptamer, and we opted for the fluorescent broccoli aptamer, which, when bound to the fluorophore DFHBI-1T, will produce green fluorescence upon excitation.
 +
We design the single broccoli aptamer (abbreviated “<strong>sB</strong>”) surrounded by two tRNA scaffolds to increase its stability (inspired from what other igem teams have noticed(iGEM20_Edinburgh)) in combination with the HREminimal and EREminimal responsive elements.
 +
The reason for this choice is that we discovered a synthesis limitation during a preliminary check on our sponsor IDT's website.
 +
 
 +
The ready-to-be-synthesized DNA templates named T7-HREminimal-sB-T and T7-EREminimal-sB-T are shown in the image below:
 +
 
 +
<html>
 +
<center>
 +
    <figure>
 +
        <img src="https://static.igem.wiki/teams/5107/eng-parts-re.webp"width="600" height="200">
 +
        <figcaption><b>Figure 3:</b><i>Overview of the T7-HREminimal-sB-T and T7-EREminimal-sB-T DNA fragments used for the cell-free system. T7 promoter, response elements, aptamer parts and terminators are shown. Not to scale.</i></figcaption>
 +
    </figure>
 +
</center>
 +
</html>
 +
 
 +
 
 +
 
 +
{| class="wikitable"
 +
|+ Primers for IVT Template
 +
|-
 +
! !! Forward Primer !! Reverse Primer
 +
|-
 +
| IVT Template || gcggataacaatttcacacaggaaacagc || caaaaaacccctcaagacccg
 +
|}
 +
''Table 2: Primer for IVT template amplification''
 +
 
 +
*Validation
 +
 
 +
As we mentioned above, the construct is ready-to-be-synthesized, that means it is delivered to us by IDT as a G-block. Then using appropiate primers(Table 2) we amplify and purify the IVT template used in our biosensor.
 +
Here it is shown only the gel electrophoresis of the T7-HREminimal-sB-T.
 +
 
 +
<html>
 +
<center>
 +
    <figure>
 +
        <img src="https://static.igem.wiki/teams/5107/parts/pcr-remin.webp" height="300" alt="PCR validation of the ROSALIND templates">
 +
        <figcaption><b>Figure 4:</b><i> PCR validation of the cell free biosensor template(T7-HREminimal-sB-T) in 1% gel agarose-SYBR Safe</i></figcaption>
 +
    </figure>
 +
</center>
 +
</html>
 +
 
 +
==Test and Optimization==
 +
 
 +
To test the created parts, we performed two iterations. Firstly, we tested and optimized the fluorescence output without the presence of any receptor or ligand (Test & Learn I), to ensure that the design at its basic level works properly.
 +
Secondly, we proceeded by testing the biosensor on its whole with the receptor and the ligands (Test & Learn II).
 +
 
 +
1. '''Wavelength and Plate reader setting'''
 +
*Rationale: As the signal for the first experiments was erratic and sometimes incoherent, we tried to improve the reading settings.
 +
 
 +
*Result:Higher fluorescence output was yielded by: 
 +
Using the wavelength couple 488/530 nm.
 +
Reading from the top (instead from the bottom)
 +
 
 +
<html>
 +
<center>
 +
    <figure>
 +
        <img src="https://static.igem.wiki/teams/5107/parts/wavelength-comparison-dark.webp" height="300" alt="">
 +
        <figcaption><b>Figure 5:</b> <i>Wavelength optimization.Fluorescein sodium salt was used as reference.</i></figcaption>
 +
    </figure>
 +
</center>
 +
</html>
 +
2. '''Buffer test'''
 +
*Rationale: Optimize the reaction to increase the signal
 +
 
 +
Initially, for the first transcription test, we used a custom In Vitro Transcription (IVT) buffer recommended from the ROSALIND protocol (where we took the inspiration for the cell-free system). However, we didn’t get any fluorescence emission by using that custom buffer.
 +
 
 +
*Result: The commercial In Vitro Transcription (IVT) buffer was better than the custom made.
 +
When using the commercial buffer, we could see a much higher output signal. The custom buffer clearly is not ideal for the cell-free transcription, while the commercial buffer seems to work much better. A possible explanation for this, is the ionic concentration, which is much higher in the custom buffer (especially NaCl). Either the indicated concentrations were wrong (we in fact acknowledge a mistake in the ROSALIND protocol, as the indicated concentration of the NaCl ion was too high) or we made a mistake in the process of preparing it.
 +
 
 +
===<strong>For the rest of the characterisations, check [https://parts.igem.org/Part:BBa_K5107007 BBa_K5107007]</strong>===
 +
 
 +
<!--
 +
3. '''DNA concentration'''
 +
*Rationale: Increase the sensitivity of the biosensor, enlarge the limits of detection, and reduce the cost of testing.
 +
Reducing the amount of DNA enhances both sensitivity and the limit of detection, which are critical factors for our stakeholders. This reduction will ultimately lower the detection threshold, allowing even trace amounts of EDCs in the tested water to produce measurable inhibition. Additionally, it enables us to minimize the use of the receptor, the most expensive component of the biosensor system.
 +
*Results: A concentration of 10 nM of DNA was sufficient to yield a substantial signal and the best one to perform the next experiments, also according to the Modeling analysis.
 +
 
 +
<html>
 +
<center>
 +
    <figure>
 +
        <img src="https://static.igem.wiki/teams/5107/parts/dna-comparison-narrow-dark.webp"  height="300"alt="">
 +
        <figcaption><b>Figure 6:</b> Test for different DNA concentrations in order to have a readable and measurable signal. Measurements were taken after 1 hour for 20 minutes. Error bars represent standard deviation of triplicates.</figcaption>
 +
    </figure>
 +
</center>
 +
</html>
 +
<!-- -->
  
 
===Sequence and Features===
 
===Sequence and Features===
Line 14: Line 157:
  
  
−
===References===
 
−
1.Miller, C. A., Tan, X., Wilson, M., Bhattacharyya, S., & Ludwig, S. (2010). Single plasmids expressing human steroid hormone receptors and a reporter gene for use in yeast signaling assays. Plasmid, 63(2), 73–78. https://doi.org/10.1016/j.plasmid.2009.11.003
 
  
−
‌
+
<!-- Uncomment this to enable Functional Parameter display
−
2.Tan, M. E., Li, J., Xu, H. E., Melcher, K., & Yong, E. (2014). Androgen receptor: structure, role in prostate cancer and drug discovery. Acta Pharmacologica Sinica, 36(1), 3–23. https://doi.org/10.1038/aps.2014.18
+
===Functional Parameters===
 +
<partinfo>BBa_K5107008 parameters</partinfo>
 +
<!-- -->
 +
 
 +
===References===
 +
<html>
 +
<ol>
 +
    <li id="ref1">
 +
        Chen, R., Cheng, H., Jin, P., Song, L., Yue, T., Hull, M., & Mansell, T. J. (2020).
 +
        <i>Nature Biotechnology</i>, <i>38</i>(10), 1107–1112. https://doi.org/10.1038/s41587-020-0571-7
 +
    </li>
 +
</ol>
 +
</html>

Latest revision as of 23:21, 1 October 2024


T7-EREmin-sB-T

T7-EREminimal-sB-T is a construct used in the cell free biosensor.The EREmininimal is recognised by the steroid estrogen hormone receptor. Through this interaction, the in vitro transcription of a monomeric broccoli aptamer is controlled based on the presence of EDCs.

Usage and Biology

For the structure of the biosensor, we took inspiration from the ROSALIND cell-free biosensor[1], modifying their design to match our goals. We kept the general idea of having a Transcription Factor (TF) altering the activity of a RNA polymerase, and the output signal as a consequence. We tailored the ROSALIND concept by selecting specific custom transcription factors (TFs) as receptors and designing unique operator sequences to serve as responsive elements.

Cell free biosensor

This is the principal function of our desinged biosensor

Cell-Free System Part 1
Figure 1: Cell-Free System - No Hormone/EDC in the environment.
Cell-Free System Part 2
Figure 2: Cell-Free System - Hormone/EDC in the environment.
When no EDC is present(Figure 1), the receptor will not bind the DNA, and thus the T7 RNAP is free to interact with the promoter, and transcribe the Broccoli aptamer. Once produced, the aptamer binds to the DFHBI-1T fluorophore, and enables fluorescence, by absorbing light at 472 nm and emitting it at 507 nm. When an EDC is present(Figure 2), it will bind the hormone receptor and induce a conformational change that will allow it to bind the receptor response element. Once the receptor is bound to the DNA, it will act as a repressor, suppressing the transcription from the T7 RNA promoter.

Assembly

Human Receptor Information
Human Receptor Response Element (Operator Site) Natural Hormone Plasmid Name (In-Cell System)
Estrogen Receptor α (ERα) ERE 17β-Estradiol pRR-ERalpha-5Z
Estrogen Receptor β (ERβ) ERE 17β-Estradiol pRR-ERbeta-5Z
Glucocorticoid Receptor (GR) HRE Dexamethasone pRR-GR-5Z
Androgen Receptor (AR) HRE Testosterone pRR-AR-5Z
Mineralocorticoid Receptor (MR) HRE Aldosterone pRR-MR-5Z
Progesterone Receptor (PR) HRE Progesterone pRR-PR-5Z

Table 1: Human Receptor Information


We designed DNA templates using two response elements: ERE and HRE, designed to interact with the above-listed receptors (see Table 1 for details). We designed versions with only a single response element and only a single repeat. For its minimalistic approach, we denoted these parts EREminimal:BBa_K5107001 and HREminimal:BBa_K5107000.

Minimal Response Elements
Element Sequence
EREminimal CCAGGTCAGAGTGACCTG
HREminimal AGAACAGAGTGTTCT

Table 2: Minimal Response Elements


  • Design - Generating a measurable readout

As for the output, we decided to go for a less tedious reporter than the one previously used. For our cell-free system, the simplest and fastest way to have an output is to use an aptamer, and we opted for the fluorescent broccoli aptamer, which, when bound to the fluorophore DFHBI-1T, will produce green fluorescence upon excitation. We design the single broccoli aptamer (abbreviated “sB”) surrounded by two tRNA scaffolds to increase its stability (inspired from what other igem teams have noticed(iGEM20_Edinburgh)) in combination with the HREminimal and EREminimal responsive elements. The reason for this choice is that we discovered a synthesis limitation during a preliminary check on our sponsor IDT's website.

The ready-to-be-synthesized DNA templates named T7-HREminimal-sB-T and T7-EREminimal-sB-T are shown in the image below:

Figure 3:Overview of the T7-HREminimal-sB-T and T7-EREminimal-sB-T DNA fragments used for the cell-free system. T7 promoter, response elements, aptamer parts and terminators are shown. Not to scale.


Primers for IVT Template
Forward Primer Reverse Primer
IVT Template gcggataacaatttcacacaggaaacagc caaaaaacccctcaagacccg

Table 2: Primer for IVT template amplification

  • Validation

As we mentioned above, the construct is ready-to-be-synthesized, that means it is delivered to us by IDT as a G-block. Then using appropiate primers(Table 2) we amplify and purify the IVT template used in our biosensor. Here it is shown only the gel electrophoresis of the T7-HREminimal-sB-T.

PCR validation of the ROSALIND templates
Figure 4: PCR validation of the cell free biosensor template(T7-HREminimal-sB-T) in 1% gel agarose-SYBR Safe

Test and Optimization

To test the created parts, we performed two iterations. Firstly, we tested and optimized the fluorescence output without the presence of any receptor or ligand (Test & Learn I), to ensure that the design at its basic level works properly. Secondly, we proceeded by testing the biosensor on its whole with the receptor and the ligands (Test & Learn II).

1. Wavelength and Plate reader setting

  • Rationale: As the signal for the first experiments was erratic and sometimes incoherent, we tried to improve the reading settings.
  • Result:Higher fluorescence output was yielded by: 
Using the wavelength couple 488/530 nm. 
Reading from the top (instead from the bottom)

Figure 5: Wavelength optimization.Fluorescein sodium salt was used as reference.
2. Buffer test

  • Rationale: Optimize the reaction to increase the signal

Initially, for the first transcription test, we used a custom In Vitro Transcription (IVT) buffer recommended from the ROSALIND protocol (where we took the inspiration for the cell-free system). However, we didn’t get any fluorescence emission by using that custom buffer.

  • Result: The commercial In Vitro Transcription (IVT) buffer was better than the custom made.

When using the commercial buffer, we could see a much higher output signal. The custom buffer clearly is not ideal for the cell-free transcription, while the commercial buffer seems to work much better. A possible explanation for this, is the ionic concentration, which is much higher in the custom buffer (especially NaCl). Either the indicated concentrations were wrong (we in fact acknowledge a mistake in the ROSALIND protocol, as the indicated concentration of the NaCl ion was too high) or we made a mistake in the process of preparing it.

For the rest of the characterisations, check BBa_K5107007

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]



References

  1. Chen, R., Cheng, H., Jin, P., Song, L., Yue, T., Hull, M., & Mansell, T. J. (2020). Nature Biotechnology, 38(10), 1107–1112. https://doi.org/10.1038/s41587-020-0571-7