Difference between revisions of "Part:BBa K4197013"
 
(4 intermediate revisions by the same user not shown)
Line 1: Line 1:
−
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K4197013 short</partinfo>
 
<partinfo>BBa_K4197013 short</partinfo>
  
−
Brick expressing BFP fluorescent protein with ihfB800 promoter.  
+
Blue fluorescent protein mTagBFP expressed with a constitutive promoter of <i>E. coli</i>.  
  
 
<html>
 
<html>
  
 
<h2>Introduction</h2>
 
<h2>Introduction</h2>
−
<p>This part is composed of the gene coding for the 800 first bp of the ihfB promoter. This promoter has been identified as a constitutive <i>E. coli</i> promoter (Weglenska et al., 1996). It is often used by researchers of the Toulouse Biotechnology Institute to express recombinant fluorescent proteins in <i>E. coli</i> (Barthe et al., 2020), as it is strong enough to allow correct expression and weak enough to avoid inclusion bodies. BFP protein was expressed using this promoter</p>
+
<p>This part is composed of the gene coding for the mTagBFP (<a href="https://parts.igem.org/Part:BBa_K592100">BBa_K592100</a>) bright blue fluorescent protein, under control of the 800 first base pairs of the <i>ihfB</i> promoter (see <a href="https://parts.igem.org/Part:BBa_K4197014">BBa_K4197014</a>. This promoter has been identified as a constitutive <i>E. coli</i> promoter (Weglenska et al., 1996). It was used for constitutive expression of fluorescent proteins in <i>E. coli</i> (Barthe et al., 2020) and appears as strong enough to permit sufficient expression of mTagBFP without inclusion bodies.</p>
 +
 
  
 
<h2>Construction</h2>
 
<h2>Construction</h2>
−
<p>Xxxxx xxxxx xxxxx xxxxxx xxxx</p>
 
−
   
 
  
−
<d>Xxxxxxxxxxxxx</b>
+
<p>The objective of the INSA-UPS 2022 team was to use ihfB800 promoter to express mTagBFP  into <i>E. coli</i> Tuner (DE3) cells.
−
                Xxxxxxxxxxxxx.
+
The functionality of the promoter and protein were confirmed as the mTagBFP was successfully expressed (see <a href="https://parts.igem.org/Part:BBa_K4197001">BBa_K4197001</a>).
−
            </div>
+
<h2>References</h2>
−
        </div>
+
−
    </div>
+
−
</div>
+
−
   
+
−
<h2>titre 2</h2>
+
−
<h3>Titre 3</h3>
+
−
<p>Xxxxxxxxxx</p>
+
−
<ul>
+
−
    <li>Forward : TAAGAAGGAGATATACCATGGCGGAAGCGGGTATCACC</li>
+
−
    <li>Reverse : CTCGAGTGCGGCCGCAAGCTTCGGATCGTCCTATGATGGAGG</li>
+
−
</ul>
+
−
<p>Xxxxxxxxxx</p>
+
−
<ul>
+
−
    <li>CForward : CGCGGCCGCTTCTAGAGCGGAAGCGGGTATCACC</li>
+
−
    <li>Reverse : AGCGGCCGCTACTAGTCGGATCGTCCTATGATGGAGG</li>
+
−
</ul>
+
  
 +
<p>More information about the project for which the part was created:<a href="https://2022.igem.wiki/toulouse-insa-ups/index.html"> DAISY (INSA-UPS 2022)</a> </p>
  
−
<h3>titre 3</h3>
+
<p>Other parts of fluorescent proteins with ihfB800:<br>
−
    <h4>Titre 4</h4>
+
−
<p>Xxxxxx</p>
+
  
−
                 
+
- <a href="https://parts.igem.org/Part:BBa_K4197012">mRFP1</a><br>
−
<h4>Titre 4</h4>
+
- <a href="https://parts.igem.org/Part:BBa_K4197022">mScarlet-I</a><br>
−
<p>xxxxxxx</p>
+
</p>
  
−
<h2>Titre 2</h2>
 
−
<p>Xxxxxx</p>
 
−
<h2>References</h2>
 
 
<ol>
 
<ol>
 
     <i>
 
     <i>
−
     <li>Morag E, Lapidot A, Govorko D, Lamed R, Wilchek M, Bayer EA, Shoham Y: Expression, purification, and characterization of the cellulose-binding domain of the scaffoldin subunit from the cellulosome of Clostridium thermocellum. Applied and Environmental Microbiology 1995, 61:1980-1986.</li>
+
     <li>Wȩgleńska, A., Jacob, B., & Sirko, A. (1996). Transcriptional pattern of Escherichia coli ihfB (himD) gene expression. Gene, 181(1-2), 85–88. https://doi.org/10.1016/s0378-1119(96)00468-4</li>
−
     <li>Nogueira ES, Schleier T, Durrenberger M, Ballmer-Hofer K, Ward TR, Jaussi R: High-level secretion of recombinant full-length streptavidin in Pichia pastoris and its application to enantioselective catalysis. Protein Expr Purif 2014, 93:54-62. DOI: 10.1016/j.pep.2013.10.015.</li>
+
     <li>Barthe, M., Tchouanti, J., Gomes, P. H., Bideaux, C., Lestrade, D., Graham, C., Steyer, J.-P., Meleard, S., Harmand, J., Gorret, N., Cocaign-Bousquet, M., & Enjalbert, B. (2020). Availability of the Molecular Switch XylR Controls Phenotypic Heterogeneity and Lag Duration during Escherichia coli Adaptation from Glucose to Xylose. mBio, 11(6), Article e02938-20. https://doi.org/10.1128/mbio.02938-20</i>
−
    <li>Young TS, Schultz PG: Beyond the canonical 20 amino acids: expanding the genetic lexicon. J Biol Chem 2010, 285:11039-11044. DOI: 10.1074/jbc.R109.091306.</li>
+
−
</i>
+
 
</ol>
 
</ol>
 
</html>
 
</html>
−
 
  
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here

Latest revision as of 17:51, 8 October 2022

mTagBFP under control of ihfB800 promoter

Blue fluorescent protein mTagBFP expressed with a constitutive promoter of E. coli.

Introduction

This part is composed of the gene coding for the mTagBFP (BBa_K592100) bright blue fluorescent protein, under control of the 800 first base pairs of the ihfB promoter (see BBa_K4197014. This promoter has been identified as a constitutive E. coli promoter (Weglenska et al., 1996). It was used for constitutive expression of fluorescent proteins in E. coli (Barthe et al., 2020) and appears as strong enough to permit sufficient expression of mTagBFP without inclusion bodies.

Construction

The objective of the INSA-UPS 2022 team was to use ihfB800 promoter to express mTagBFP into E. coli Tuner (DE3) cells. The functionality of the promoter and protein were confirmed as the mTagBFP was successfully expressed (see BBa_K4197001).

References

More information about the project for which the part was created: DAISY (INSA-UPS 2022)

Other parts of fluorescent proteins with ihfB800:
- mRFP1
- mScarlet-I

  1. Wȩgleńska, A., Jacob, B., & Sirko, A. (1996). Transcriptional pattern of Escherichia coli ihfB (himD) gene expression. Gene, 181(1-2), 85–88. https://doi.org/10.1016/s0378-1119(96)00468-4
  2. Barthe, M., Tchouanti, J., Gomes, P. H., Bideaux, C., Lestrade, D., Graham, C., Steyer, J.-P., Meleard, S., Harmand, J., Gorret, N., Cocaign-Bousquet, M., & Enjalbert, B. (2020). Availability of the Molecular Switch XylR Controls Phenotypic Heterogeneity and Lag Duration during Escherichia coli Adaptation from Glucose to Xylose. mBio, 11(6), Article e02938-20. https://doi.org/10.1128/mbio.02938-20

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal EcoRI site found at 1526
    Illegal XbaI site found at 1511
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal EcoRI site found at 1526
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
    Illegal NotI site found at 1518
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal EcoRI site found at 1526
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal EcoRI site found at 1526
    Illegal XbaI site found at 1511
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal EcoRI site found at 1526
    Illegal XbaI site found at 1511
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
    Illegal AgeI site found at 329
  • 1000
    COMPATIBLE WITH RFC[1000]