Difference between revisions of "Part:BBa K4197019"

 
(3 intermediate revisions by 2 users not shown)
Line 3: Line 3:
 
<partinfo>BBa_K4197019 short</partinfo>
 
<partinfo>BBa_K4197019 short</partinfo>
  
Gene coding for DARPin e2_79 which is a protein that recognises the constant part of IgE.  
+
Gene coding for DARPin e2_79 which is a protein that recognises the constant part of IgE (Baumann et al., 2010).  
  
  
Line 9: Line 9:
  
 
<h2>Introduction</h2>
 
<h2>Introduction</h2>
<p>Xxxxx xxxxx xxxxx xxxxxx xxxx</p>
+
<p>This part is composed of the gene coding for the DARPin E2_79 protein. DARPin is a protein that recognizes the constant part of IgE (Baumann et al., 2010). It has already been expressed in <i> E. coli </i> </p>
  
 
<h2>Construction</h2>
 
<h2>Construction</h2>
<p>Xxxxx xxxxx xxxxx xxxxxx xxxx</p>
+
<p>The objective of the INSA-UPS 2022 team was to display DARPin E2_79 on the surface of <i>E. coli</i> so the ordered sequence was merged to OmpA membrane lipoprotein (see part <a href="https://parts.igem.org/Part:BBa_K4197011">BBa_K1694011</a>).</p>
   
+
  
<div class="center">
+
                    
        <div class="thumb tnone">
+
            <div class="thumbinner" style="width:50%;">
+
                <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="image">
+
                    <img alt="" src="/wiki/images/7/7e/T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
+
                    <div class="magnify">
+
                        <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="internal" title="Enlarge"></a>
+
                    </div>
+
                    <b>Figure 1: </b> <b>Xxxxxx</b> 
+
                   Xxxxxxxxxxxxxxxxxxxxxxxxxxx.
+
                </div>
+
            </div>
+
        </div>
+
    </div>
+
<h2>Xxxxxxxxx</h2>
+
<p>Xxxxxxxxxxxxx</p>
+
<div class="center">
+
    <div class="thumb tnone">
+
        <div class="thumbinner" style="width:80%;">
+
            <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" class="image">
+
                <img alt="" src="https://static.igem.org/mediawiki/2018/5/5b/T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
+
                <div class="magnify">
+
                    <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" class="internal" title="Enlarge"></a>
+
                </div>
+
                <b>Figure 2: </b> <b>Xxxxxxxxxxxxx</b> 
+
                Xxxxxxxxxxxxx.
+
            </div>
+
        </div>
+
    </div>
+
</div>
+
   
+
<h2>titre 2</h2>
+
<h3>Titre 3</h3>
+
<p>Xxxxxxxxxx</p>
+
<ul>
+
    <li>Forward : TAAGAAGGAGATATACCATGGCGGAAGCGGGTATCACC</li>
+
    <li>Reverse : CTCGAGTGCGGCCGCAAGCTTCGGATCGTCCTATGATGGAGG</li>
+
</ul>
+
<p>Xxxxxxxxxx</p>
+
<ul>
+
    <li>CForward : CGCGGCCGCTTCTAGAGCGGAAGCGGGTATCACC</li>
+
    <li>Reverse : AGCGGCCGCTACTAGTCGGATCGTCCTATGATGGAGG</li>
+
</ul>
+
  
 +
<h2>References</h2>
  
<h3>titre 3</h3>
+
<p>More information about the project for which the part was created:<a href="https://2022.igem.wiki/toulouse-insa-ups/index.html"> DAISY (INSA-UPS 2022)</a> </p>
    <h4>Titre 4</h4>
+
<p>Xxxxxx</p>
+
  
                 
+
<p>Other parts to display allergens:<br>
<h4>Titre 4</h4>
+
  <p>Other parts using the DARPin:<br>
<p>xxxxxxx</p>
+
  
<h2>Titre 2</h2>
+
- <a href="https://parts.igem.org/Part:BBa_K4197011">OmpA_DARPin</a><br>
<p>Xxxxxx</p>
+
- <a href="https://parts.igem.org/Part:BBa_K4197010">OmpA_DARPin_sfGFP</a><br>
<h2>References</h2>
+
- <a href="https://parts.igem.org/Part:BBa_K4197001"> OmpA_DARPin fusion + ihfB800-mTagBFP</a><br>
 +
</p>
 
<ol>
 
<ol>
 
     <i>
 
     <i>
     <li>Morag E, Lapidot A, Govorko D, Lamed R, Wilchek M, Bayer EA, Shoham Y: Expression, purification, and characterization of the cellulose-binding domain of the scaffoldin subunit from the cellulosome of Clostridium thermocellum. Applied and Environmental Microbiology 1995, 61:1980-1986.</li>
+
     <li>Baumann, M. J., Eggel, A., Amstutz, P., Stadler, B. M., & Vogel, M. (2010). DARPins against a functional IgE epitope. Immunology Letters, 133(2), 78–84. https://doi.org/10.1016/j.imlet.2010.07.005 </li>
    <li>Nogueira ES, Schleier T, Durrenberger M, Ballmer-Hofer K, Ward TR, Jaussi R: High-level secretion of recombinant full-length streptavidin in Pichia pastoris and its application to enantioselective catalysis. Protein Expr Purif 2014, 93:54-62. DOI: 10.1016/j.pep.2013.10.015.</li>
+
 
    <li>Young TS, Schultz PG: Beyond the canonical 20 amino acids: expanding the genetic lexicon. J Biol Chem 2010, 285:11039-11044. DOI: 10.1074/jbc.R109.091306.</li>
+
 
</i>
 
</i>
 
</ol>
 
</ol>
 
</html>
 
</html>
 +
  
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here
Line 85: Line 41:
 
<!-- -->
 
<!-- -->
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>
<partinfo>BBa_K4197014 SequenceAndFeatures</partinfo>
+
<partinfo>BBa_K4197019 SequenceAndFeatures</partinfo>
  
  
 
<!-- Uncomment this to enable Functional Parameter display  
 
<!-- Uncomment this to enable Functional Parameter display  
 
===Functional Parameters===
 
===Functional Parameters===
<partinfo>BBa_K4197014 parameters</partinfo>
+
<partinfo>BBa_K4197019 parameters</partinfo>
 
<!-- -->
 
<!-- -->

Latest revision as of 22:29, 8 October 2022


DARPin e2_79

Gene coding for DARPin e2_79 which is a protein that recognises the constant part of IgE (Baumann et al., 2010).


Introduction

This part is composed of the gene coding for the DARPin E2_79 protein. DARPin is a protein that recognizes the constant part of IgE (Baumann et al., 2010). It has already been expressed in E. coli

Construction

The objective of the INSA-UPS 2022 team was to display DARPin E2_79 on the surface of E. coli so the ordered sequence was merged to OmpA membrane lipoprotein (see part BBa_K1694011).

References

More information about the project for which the part was created: DAISY (INSA-UPS 2022)

Other parts to display allergens:

Other parts using the DARPin:
- OmpA_DARPin
- OmpA_DARPin_sfGFP
- OmpA_DARPin fusion + ihfB800-mTagBFP

  1. Baumann, M. J., Eggel, A., Amstutz, P., Stadler, B. M., & Vogel, M. (2010). DARPins against a functional IgE epitope. Immunology Letters, 133(2), 78–84. https://doi.org/10.1016/j.imlet.2010.07.005


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal AgeI site found at 205
  • 1000
    COMPATIBLE WITH RFC[1000]