Difference between revisions of "Part:BBa K515100"

Experimental Data

Salkowski Assay

Figure 2: Standard curve of Salkowski assay made with synthetic IAA in LB

Figure 3: Cuvettes used to measure OD for the standard curve. As IAA concentration increases, the solution turns red.

The Salkowski assay is a colourimetric assay that detects IAA with high specificity among other indoles. There are many different types of Salkowski reagents which work at different concentration ranges of IAA and with varying specificity. They all vary slightly in composition and measurement method. We used the most specific reagent according to a paper which works at a concentration range of 0-260 µM. Modelling of the IAA producing construct informed us that IAA production would be within this range. This standard assay is the simplest way to determine whether there is IAA present in solution. First, we created a standard curve with increasing IAA concentration in LB broth using synthetic IAA (Figure 1&2). This was used to determine IAA concentration from OD measurements of IAA-producing E. coli DH5α.

Figure 4: Results from trial 1 of Salkowski assay with cell filtrate of IAA-producing E. coli DH5α. Filtered through a 0.2 µm pore filter

Figure 5: Visual results correlating with OD measurements. The eppendorf on the right contains IAA producing E. coli DH5α and the eppendorf on the left contains control E. coli DH5α.

We found that our IAA producing E. coli were producing approximately 55 µM IAA. From modelling, we have determined that our construct would be able to produce 72.25 μM IAA, which shows that we were in the correct order of magnitude. E. coli are known to naturally express IAA, although the pathway is uncharacterised, which is why all of our controls showed moderate levels of IAA production^[3]. However, cells containing the Auxin Xpress construct have repeatedly shown to produce almost twice as much IAA.

IAA is known to degrade quite rapidly so we tested the effect of light exposure on IAA detection by Salkowski. Interestingly, from testing the Salkowski assay on synthetic IAA in LB left overnight in dark versus light suggests that light exposure does lead to IAA degradation (Figure 6).

Figure 6: Testing the effect of light exposure on synthetic IAA stability. The cuvette on the left shows the colour change at point zero. The three middle cuvettes were left in the dark overnight and the three on the right were left exposed to light, after which Salkowski reagent was added to all samples to observe colour change.

Figure 7: Salkowski assay performed on IAA producing E. coli and control E. coli incubated for 20 hours in different media. All samples were incubated in the dark.

Due to the results of the light exposure test, all future cultures were incubated in the dark. We did another assay on E. coli DH5α cultures expressing the auxin construct to compare IAA production when incubated in two different media, LB and tryptone broth (Figure 7). Surprisingly, the results suggest that IAA production was optimal in LB, although the OD at 600 nm of cultures grown in tryptone broth (very nutrient rich) was much higher. We cannot draw a conclusion from this data, however it seems that the IAA producing pathway endogenous to E. coli is much more complicated than anticipated. We may postulate that IAA is not produced when growth conditions are very favourable and cell density is high.

HPLC

Since the BL21 strain of E. coli was saturating the Salkowski reagent we looked for alternative quantification methods to measure the amount of IAA being produced by BL21 cells containing the Auxin Xpress construct. The extraction method we used resulted in a large loss in IAA from the cell filtrate and no peaks were detected by HPLC, therefore we ran filtered cell supernatant directly through the column and the peak characteristic to IAA at 227 nm was visible.

From the positive control, only one peak at 227 nm showed up at about 15 mins so we knew that this corresponded to IAA and looked for the same peak in our samples between 15 and 16 minutes.

Considerably smaller IAA peaks were present in the sample of interest and negative control and a difference in magnitude between the two could not be determined (Figure 8). Therefore we needed an even more sensitive approach to accurately determine how much IAA our engineered bacteria were producing.

Figure 8: HPLC peak corresponding to IAA. Positive control is 50 μM IAA in acetonitrile. Auxin Xpress is filtered supernatant of E. coli BL21 transformed with the Auxin Xpress construct. Negative control is filtered supernatant of E. coli BL21 transformed with a vector containing only a promoter and antibiotic resistance.

.

LCMS

Finally we did liquid chromatography mass spectrometry (LCMS) to confirm that IAA was present in our sample. This highly quantitative method combines HPLC and mass spectrometry allowing detection of nano-molar concentrations. Dr Colin Turnbull and his team kindly ran our samples for us. E. coli strain BL21 were used to maximise IAA output.

The characteristic IAA peak detected by LCMS confirms that IAA is being produced by cells with the Auxin Xpress construct (Figure 9). Unfortunately the extraction method resulted in a high loss of IAA in the sample (post extraction concentrations were nearly 12 fold lower than pre-extraction). Although the relative levels of IAA are still informative, we hope to optimise the extraction in the future to improve the yield of IAA.

Figure 9: Peaks produced from LCMS, the peak area of the MRM transition 176-130 was used to quantify IAA. The bottom window shows the peak for authentic IAA run in the same batch compared to the test sample extracted from our engineered bacteria. The peak around four and a half minutes corresponds to another unkown metabolite. The peak at about six and a half minutes corresponds to IAA.

References

[1] Spaepen S. et al. (2007) Indole-3-acetic acid in microbial and microorganism-plant signaling. Federation of European Microbiological Societies Microbiology Reviews 31: 425–448.

[2] Palm CJ et al. (1989) Cotranscription of genes encoding indoleacetic acid production in Pseudomonas syringae subsp. savastanoi. Journal of Bacteriology 171(2): 1002-1009.

[3] Ball, E(1938) Heteroauxin and the growth of Escherichia coli. Journal of Bacteriology 36(5):. 559-565.

Contribution: NUDT_CHINA 2015

Author: Xinyuan Qiu

Summary: We built two new parts based on this part to extend its function.

This part is the only one available with IAAM and IAAH , but unfortunately, we noticed that neither of the CDS of those two enzyme were submitted to the registry (they were only registered as BBa_K515000 and K515001). Thus, several improvements were made based on the part K515100 to provide an available version of IAAM and IAAH.

Two pairs of enzymes that can PCR-prep the CDS of IaaM and IaaH

For IAAM

F-Prime: 5’- GGAATTCGCGGCCGCTTCTAGAGATGTTTGGACCGG-3’

R-Prime: 5’- GCGGCGGACTAGTCTTATTAGTCCCCCAGCG -3’

For IAAH

F-Prime: 5’- GGAATTCGCGGCCGCTTCTAGAGATGCGCGAAATG -3’

R-Prime: 5’- GCGGGCGGCGGACTAGTCTTATTAGCCTTTTAACAC -3’

Two new bio-bricks were designed based on this part using the primers above

See BBa_K1789000 and BBa_K1789001

Both of those parts were sent to the registry.

Contribution: Universität Potsdam 2017

Author: Felix Lohrke

Summary: We upgraded this part by adding MS2 and PP7 RNA-binding-proteins.

We modified this part so that it is possible to synthesize the IAA-enzymes with RBP`s to be able to bind to specific aptamers.

For more information see BBa_K2483000 The part was sent to iGEM-HQ.

Functional Parameters: Austin_UTexas

Burden Imposed by this Part:

Burden is the percent reduction in the growth rate of E. coli cells transformed with a plasmid containing this BioBrick (± values are 95% confidence limits). This part exhibited a significant burden. Users should be aware that BioBricks with a burden of >20-30% may be susceptible to mutating to become less functional or nonfunctional as an evolutionary consequence of this fitness cost. This risk increases as they used for more bacterial cell divisions or in larger cultures. Users should be especially careful when combining multiple burdensome parts, as plasmids with a total burden of >40% are expected to mutate so quickly that they become unclonable. Refer to any one of the BBa_K3174002 - BBa_K3174007 pages for more information on the methods and other conclusions from a large-scale measurement project conducted by the 2019 Austin_UTexas team.

This functional parameter was added by the 2020 Austin_UTexas team.

contribution of Whittle 2021

These datas below contributed by Whittle iGEM team 2021.

Enzyme and construction of IAM Pathway

There are two enzymes in the IAM pathway, iaaM and iaaH (amiE/ami1). L-tryptophan will be turned into indole-3-acetamide by iaaM, and then become IAA by iaaH. As shown in Figure 4, IAM pathway is used by two different promoters in our experiment. One of the promoters is pVeg2 and this formed a pathway (BBa_K515100) that Imperial College London had used in 2011. Another promoter is Ptac. The Ptac promoter is a functional hybrid promoter which is controlled by IPTG.

We did Salkowiski test on our Iam pathway and the original IAM pathway. From the results, the IAM pathway of pVeg2 promoter is indeed better than our PTAC pathway, but the gap is not large.

From the results of Salkowiski test (Figure 5), we can see the tilter of IAA produced by IPA pathway of Ptac (Ptac-IPA) is much higher than the IAM pathway of Ptac (Ptac-IAM). In the best group we induced, the titer of IAA in Ptac-IPA reached 154.27mg/L at 48 hour. By calculation, the yield is up to 88%. In contrast, in this group of Salkowiski test, although the IAA yield of Ptac-IPA was only 53% at 48 hours, the yield of Ptac-IAM was only 8%, and the yield of control group was 13%. The production of IAA in the IPA pathway is more than three times higher than the IAM pathway. This can prove the advantage of IPA pathway.

In these characterization experiments, we found that the efficiency of new IPA pathway converting Trp into IAA is about 4 times higher than IAA pathway. We believe the part BBa_K4013020 it's a functional improvement of this part.