Difference between revisions of "Recombination/Saccharomyces cerevisiae-derived Flp-FRT"

Latest revision as of 10:05, 3 November 2010

< Back to Recombination systems, DNA recombination sites, or Recombinases

Chris Anderson, a professor of bioengineering at UC Berkeley, constructed the FRT recombination site BBa_J61020.

The following text is excerpted from Huang et al. Huang. It has been edited for clarity.

The FLP system of the yeast 2mm plasmid is one of the most attractive for genomic manipulation because of its efficiency, simplicity, and demonstrated in vivo activity in a wide range of organisms. The Flp system has been used to construct specific genomic deletions and gene duplications, study gene function, promote chromosomal translocations, promote site-specific chromosome cleavage, and facilitate the construction of genomic libraries in organisms including bacteria, yeast, insects, plants, mice, and humans. Site-specific recombination catalyzed by the FLP recombinase occurs readily in bacterial cells.

The yeast FLP system has been studied intensively (7, 8, 22, 36). The only requirements for FLP recombination are the FLP protein and the FLP recombination target (FRT) sites on the DNA substrates. The minimal functional FRT site contains only 34 bp. The FLP protein can promote both inter- and intramolecular recombination.

Recombination sites

*More...*
Name	Description	Sequence	Recombinase	Length
BBa_J61020	[FRT]	. . . ttcctatactttttagagaataggaacttc		34
BBa_J72001	{FRT} recombination site for flp recombinase in BBb	. . . ttcctatactttctagagaataggaacttc		36

Recombinases

BBa_K313002

Composite parts

*More...*
Name	Type	Description	Length	Status
BBa_K551000	Composite	FRT-CM-FRT	837	It's complicated
BBa_J61024	Composite	[CmR][FRT]	936	It's complicated
BBa_J61025	Composite	[FRT][CmR][FRT]	978	It's complicated
BBa_J61026	Composite	[FRT][R6K]	448	It's complicated
BBa_J61027	Composite	[FRT][R6K][CmR][FRT]	1392	It's complicated

References

Schweizer pmid=12736528
Huang pmid=9324255
Cherepanov pmid=7789817
Cox pmid=6308608
Fiering pmid=8378321
Golic pmid=2509077
Morris pmid=1945877
Sadowski pmid=7659779
Senecoff pmid=2997780

</biblio>

@@ Line 29: / Line 29: @@
 ===Recombinases===
-There are not Flp recombinase parts available currently.
+[[Part:BBa_K313002|BBa_K313002]]
 <!-- <parttable>flp_recombinase_protein_coding_sequence </parttable> -->
 <!-- To include a part in this table, include the categories "//cds/enzyme/recombinase/flp" and set the part type to Coding under the Hard Information tab of the part. -->
+===Composite parts===
+<parttable>flp_frt_recombination_composite_parts</parttable>
+<!-- To include a part in this table, include the categories "//function/recombination/flp" and make it a composite part under the Hard Information tab of the part. -->
 ===References===