Difference between revisions of "Part:BBa K3037001"
(→Description) |
|||
(63 intermediate revisions by 4 users not shown) | |||
Line 4: | Line 4: | ||
|- | |- | ||
|'''Function''' | |'''Function''' | ||
− | | | + | |Affinity tag and improved protein solubility |
|- | |- | ||
|'''Use in''' | |'''Use in''' | ||
− | |Escherichia coli | + | |<span style="font-style: italic;">Escherichia coli</span> |
|- | |- | ||
|'''RFC standard''' | |'''RFC standard''' | ||
− | | | + | |[[Help:Assembly_standard_25|Freiburg RFC25 standard]] |
|- | |- | ||
|'''Backbone''' | |'''Backbone''' | ||
− | |pSB1C3<br> | + | |[https://parts.igem.org/Help:2019_DNA_Distribution pSB1C3<br>] |
+ | |- | ||
+ | |'''Experimental Backbone''' | ||
+ | |[https://parts.igem.org/Part:BBa_K3037000 pOCC97<br>] | ||
|- | |- | ||
|'''Submitted by''' | |'''Submitted by''' | ||
− | |Team: | + | |Team: [https://2019.igem.org/Team:TU_Dresden TU_Dresden 2019] |
|} | |} | ||
− | + | == Overview == | |
− | The | + | The [https://2019.igem.org/Team:TU_Dresden TU_Dresden 2019] team designed this BioBrick in order to make a fusion protein [https://parts.igem.org/Part:BBa_K3037003 BBa_K3037003] in accordance to the [[Help:Assembly_standard_25|Freiburg RFC25 standard.]] |
− | MBP was | + | MBP was cloned into pOCC97 [https://parts.igem.org/Part:BBa_K3037000 (BBa_K3037000),] a vector for protein-overexpression. The final construct was evaluated in the <span style="font-style: italic;">Escherichia coli (E. coli)</span> pRARE T7 strain. [https://2019.igem.org/Team:TU_Dresden/Parts (more information)] |
− | + | This here presented MBP, is a great improvement to the iGEMs registry since we added up and down stream preScission sites. These enables, quick and easy cleavage of MBP after protein purification mediated by 3C protease if desired. Continue reading for more information. | |
− | + | == Description == | |
+ | |||
+ | <div style="text-align:justify;"> | ||
+ | MBP is a well-established, reliable protein-tag that is meant to increase the solubility of the proteins it is fused to. Therefore it limits the risk of aggregation of overexpressed recombinant protein in inclusion bodies and increases the available protein yield. It can also improve expression of difficult enzymes like Cas9. It can further be used to purify proteins via affinity chromatography in amylose resin.[1] | ||
+ | |||
+ | Additionally, in this Biobrick a preScission site was included upstream and downstream of the coding sequence, so the tag can be easily removed after purification in a digest. Additionally the preScission sequence acts as a linker, and thereby limits the risk of steric hindrance. | ||
+ | |||
+ | Many times in synthetic biology we design our own proteins, enzymes or new fusions of already existing proteins for our projects. This newly designed protein will require an expression host and <span style="font-style: italic;">E. coli</span> is most of the time the first choice for this purpose. It can easily be used to produce large quantities of protein by overexpressing it. A recurring problem here can be insoluble expression, a phenomenon in which the overexpressed recombinant protein forms insoluble aggregates in the cell. These are called inclusion bodies. An easy way to circumvent this problem is to tag the protein with MBP. It was originally developed in the 1980s as an expression tag and was in the further research found to significantly increase the solubility of proteins it is fused to. [1] Additionally it strongly increases the cytoplasmic yield of the tagged protein. A common approach is to fuse it to the N-terminus of the protein in question, even though it has been shown to increase recombinant soluble expression in N- and C-terminal fusions.[1] | ||
− | |||
− | |||
The other advantage of using a MBP-fusion strategy is its ability to bind to amylose resin. This way it can be used for fast and effective single step affinity purification. This resin is much more affordable than other affinity purification methods. | The other advantage of using a MBP-fusion strategy is its ability to bind to amylose resin. This way it can be used for fast and effective single step affinity purification. This resin is much more affordable than other affinity purification methods. | ||
− | The only issue that can occur with MBP is that it can create steric hindrance with the protein it is fused to due to its size. This can be avoided by adding a linker sequence | + | The only issue that can occur with MBP is, that it can create steric hindrance with the protein it is fused to due to its size. This can be avoided by adding a linker sequence. |
− | + | ||
+ | This BioBrick as displayed in Figure 1 is designed in a way enabling the user to solve this problem from the beginning, as a recognition site of the preScission protease was added upstream and downstream of the MBP coding sequence. | ||
+ | preScission protease is a fusion protein of human rhinovirus (HRV) 3C protease and GST. It allows for on-column cleavage of tagged proteins in one step. [2] This way if the MBP, if it influences the activity of the purified protein because of its large size, can be easily cleaved off by digesting it with the preScission protease. It is suitable for on-column and off-column cleavage. | ||
− | + | [[File:T--TU Dresden--MBPmiho.png|center|800px|thumb|none|Figure 1: MBP BioBrick design representation with cleavage sites]] | |
− | + | ||
− | + | ||
+ | === Biology === | ||
− | = | + | Maltose Binding Protein is approximately 42 kDa in size and naturally occurs in <span style="font-style: italic;">E. coli</span>. It is encoded in the malE gene. MBP is responsible for the uptake, breakdown and transport of a special carbohydrate, maltodextrin. [1] |
+ | == Characterization == | ||
− | + | === Outline === | |
+ | We performed the purification of an MBP-tagged fusion protein as characterization experiment. | ||
+ | ===Experiments in detail=== | ||
+ | <b> 1. BBa_K3037003</b> | ||
− | + | A fusion protein [https://parts.igem.org/Part:BBa_K3037003 (BBa_K3037003)] with the size of 230 kDa was expressed. N-terminally it was tagged with this MBP-tag. The digestion to prepare the ligation was carried out with the restriction enzymes NgoMIV and AgeI [[Help:Assembly_standard_25|(Freiburg RFC25 standard)]], which are ensuring translational fusion. After the expression of the protein, the MBP-tag was deployed for purification (Figure 2). | |
− | + | ||
− | + | ||
− | + | ||
− | + | [[File:T--TU_Dresden--SDS-PAGE_MBP.png|center|400px|thumb|none|Figure 2: Purification of 230kDa fusion protein on amylose resin]] | |
+ | The elution fractions contain a lot of different sized proteins. It is very likely that this is not due to a lack of specificity of the amylose-MBP interaction but due to many truncated versions that are produced of the huge fusion protein. | ||
− | + | <b> 2. BBa_K3037005</b> | |
− | + | Another fusion protein with MBP was made, this one of 220 kDa protein [https://parts.igem.org/Part:BBa_K3037005 (BBa_K3037005).] It was purified using the same method in an amylose resin column with the a N-terminal-MBP-tag (Figure 3). | |
− | - | + | [[File:T--TU_Dresden--Amilose_resin_BBa_K3037005.png|center|400px|thumb|none|Figure 3: Amylose resin purification]] |
− | - | + | The comparison of lane 4 and 5 illustrates nicely the performance of the MPP-tag with the amylose resin. Upon elution in lane 5 many truncated versions appear. This was to be expected as it often occurs when expressing large recombinant proteins. The high intensity of the bands shows that previously these proteins were bound to the resin as they were not in lane 4. After the digestion with 3C protease, a very strong signal appears at 42 kDa inicating that the preScission sites are intact and were recognized. The purification of the complete transcript from the cleaved off tag was archieved by cation exchange chromatography on a HiTrap SP column. |
− | === | + | == Sequence == |
− | + | ||
− | [ | + | <partinfo>BBa_K3037001 SequenceAndFeatures</partinfo> |
+ | |||
+ | == Design Notes == | ||
+ | |||
+ | A PreScission recognition site was added upstream and downstream of the coding region. This makes it possible to cleave the MBP tag off after purification regardless of which side it was fused to. It can be specifically removed by digest with the PreScission protease. | ||
+ | This is very useful since this makes sure that the final purified version of your protein of interest will not be influenced in its function or folding by this relatively large tag. | ||
+ | |||
+ | Codon optimized for <span style="font-style: italic;">E. coli</span> with all forbidden restriction enzyme sites removed | ||
+ | |||
+ | Primers used to adapt the BioBrick to the [[Help:Assembly_standard_25|Freiburg RFC25 standard]] | ||
+ | |||
+ | Prefix: GAATTCGCGGCCGCTTCTAGATAAGGAGGTCAAAAATGGCCGGC | ||
+ | |||
+ | Suffix: ACCGGTTAATACTAGTAGCGGCCGCTGCAG | ||
+ | |||
+ | == References == | ||
+ | |||
+ | [1] https://www.genscript.com/bacterial-soluble-protein-expression-MBP-tag.html | ||
− | [ | + | [2] https://www.gelifesciences.com/en/us/shop/chromatography/resins/affinity-tagged-protein/prescission-protease-for-gst-tag-removal-p-00248 |
Latest revision as of 02:02, 22 October 2019
Maltose Binding Protein (MBP-tag)
Maltose Binding Protein | |
---|---|
Function | Affinity tag and improved protein solubility |
Use in | Escherichia coli |
RFC standard | Freiburg RFC25 standard |
Backbone | pSB1C3 |
Experimental Backbone | pOCC97 |
Submitted by | Team: TU_Dresden 2019 |
Contents
Overview
The TU_Dresden 2019 team designed this BioBrick in order to make a fusion protein BBa_K3037003 in accordance to the Freiburg RFC25 standard.
MBP was cloned into pOCC97 (BBa_K3037000), a vector for protein-overexpression. The final construct was evaluated in the Escherichia coli (E. coli) pRARE T7 strain. (more information)
This here presented MBP, is a great improvement to the iGEMs registry since we added up and down stream preScission sites. These enables, quick and easy cleavage of MBP after protein purification mediated by 3C protease if desired. Continue reading for more information.
Description
MBP is a well-established, reliable protein-tag that is meant to increase the solubility of the proteins it is fused to. Therefore it limits the risk of aggregation of overexpressed recombinant protein in inclusion bodies and increases the available protein yield. It can also improve expression of difficult enzymes like Cas9. It can further be used to purify proteins via affinity chromatography in amylose resin.[1]
Additionally, in this Biobrick a preScission site was included upstream and downstream of the coding sequence, so the tag can be easily removed after purification in a digest. Additionally the preScission sequence acts as a linker, and thereby limits the risk of steric hindrance.
Many times in synthetic biology we design our own proteins, enzymes or new fusions of already existing proteins for our projects. This newly designed protein will require an expression host and E. coli is most of the time the first choice for this purpose. It can easily be used to produce large quantities of protein by overexpressing it. A recurring problem here can be insoluble expression, a phenomenon in which the overexpressed recombinant protein forms insoluble aggregates in the cell. These are called inclusion bodies. An easy way to circumvent this problem is to tag the protein with MBP. It was originally developed in the 1980s as an expression tag and was in the further research found to significantly increase the solubility of proteins it is fused to. [1] Additionally it strongly increases the cytoplasmic yield of the tagged protein. A common approach is to fuse it to the N-terminus of the protein in question, even though it has been shown to increase recombinant soluble expression in N- and C-terminal fusions.[1]
The other advantage of using a MBP-fusion strategy is its ability to bind to amylose resin. This way it can be used for fast and effective single step affinity purification. This resin is much more affordable than other affinity purification methods. The only issue that can occur with MBP is, that it can create steric hindrance with the protein it is fused to due to its size. This can be avoided by adding a linker sequence.
This BioBrick as displayed in Figure 1 is designed in a way enabling the user to solve this problem from the beginning, as a recognition site of the preScission protease was added upstream and downstream of the MBP coding sequence. preScission protease is a fusion protein of human rhinovirus (HRV) 3C protease and GST. It allows for on-column cleavage of tagged proteins in one step. [2] This way if the MBP, if it influences the activity of the purified protein because of its large size, can be easily cleaved off by digesting it with the preScission protease. It is suitable for on-column and off-column cleavage.
Biology
Maltose Binding Protein is approximately 42 kDa in size and naturally occurs in E. coli. It is encoded in the malE gene. MBP is responsible for the uptake, breakdown and transport of a special carbohydrate, maltodextrin. [1]
Characterization
Outline
We performed the purification of an MBP-tagged fusion protein as characterization experiment.
Experiments in detail
1. BBa_K3037003
A fusion protein (BBa_K3037003) with the size of 230 kDa was expressed. N-terminally it was tagged with this MBP-tag. The digestion to prepare the ligation was carried out with the restriction enzymes NgoMIV and AgeI (Freiburg RFC25 standard), which are ensuring translational fusion. After the expression of the protein, the MBP-tag was deployed for purification (Figure 2).
The elution fractions contain a lot of different sized proteins. It is very likely that this is not due to a lack of specificity of the amylose-MBP interaction but due to many truncated versions that are produced of the huge fusion protein.
2. BBa_K3037005
Another fusion protein with MBP was made, this one of 220 kDa protein (BBa_K3037005). It was purified using the same method in an amylose resin column with the a N-terminal-MBP-tag (Figure 3).
The comparison of lane 4 and 5 illustrates nicely the performance of the MPP-tag with the amylose resin. Upon elution in lane 5 many truncated versions appear. This was to be expected as it often occurs when expressing large recombinant proteins. The high intensity of the bands shows that previously these proteins were bound to the resin as they were not in lane 4. After the digestion with 3C protease, a very strong signal appears at 42 kDa inicating that the preScission sites are intact and were recognized. The purification of the complete transcript from the cleaved off tag was archieved by cation exchange chromatography on a HiTrap SP column.
Sequence
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 381
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI site found at 79
Design Notes
A PreScission recognition site was added upstream and downstream of the coding region. This makes it possible to cleave the MBP tag off after purification regardless of which side it was fused to. It can be specifically removed by digest with the PreScission protease. This is very useful since this makes sure that the final purified version of your protein of interest will not be influenced in its function or folding by this relatively large tag.
Codon optimized for E. coli with all forbidden restriction enzyme sites removed
Primers used to adapt the BioBrick to the Freiburg RFC25 standard
Prefix: GAATTCGCGGCCGCTTCTAGATAAGGAGGTCAAAAATGGCCGGC
Suffix: ACCGGTTAATACTAGTAGCGGCCGCTGCAG
References
[1] https://www.genscript.com/bacterial-soluble-protein-expression-MBP-tag.html
[2] https://www.gelifesciences.com/en/us/shop/chromatography/resins/affinity-tagged-protein/prescission-protease-for-gst-tag-removal-p-00248