Difference between revisions of "Part:BBa K2842666"
 
(6 intermediate revisions by the same user not shown)
Line 30: Line 30:
 
|}
 
|}
  
−
This BioBrick-compatible standard with improved flexibility enables the integration of conventional cloning methods into iGEM’s workflow. Once inserted into a backbone, BioBrick2.0 allows cloning through Golden Gate assembly and Gibson assembly. At the same time, our construct has a LacZ reporter which can be used to screen plates for successful colonies. BioBrick2.0 is a new standard which can facilitate the cloning process for iGEM teams.
+
This BioBrick-compatible standard with improved flexibility enables the integration of conventional cloning methods into iGEM’s workflow. Once inserted into a backbone, BioBrick2.0 allows cloning through Golden Gate assembly and Gibson assembly. At the same time, our construct has a LacZ reporter which can be used to screen plates for successful colonies. BioBrick2.0 is a new standard which can facilitate the cloning process for future iGEM teams.
  
  
Line 36: Line 36:
 
The lacZ reporter allows for blue-white screening. It can be displaced by compatible constructs through BioBrick assembly, Golden Gate or Gibson assembly. Blue-white screening is based on the inability of commercial E. coli to metabolise galactose or structurally similar substrates like X-Gal because of a lacZ deletion mutation. Once lacZα is provided through a plasmid, X-Gal can be metabolised to an easily detectable blue compound. This screening can also be used for subsequent cloning where the displacement of lacZ results in white colonies.  
 
The lacZ reporter allows for blue-white screening. It can be displaced by compatible constructs through BioBrick assembly, Golden Gate or Gibson assembly. Blue-white screening is based on the inability of commercial E. coli to metabolise galactose or structurally similar substrates like X-Gal because of a lacZ deletion mutation. Once lacZα is provided through a plasmid, X-Gal can be metabolised to an easily detectable blue compound. This screening can also be used for subsequent cloning where the displacement of lacZ results in white colonies.  
  
−
===Compatibility===
+
 
−
For Golden Gate assembly, BsaI cut sites and defined overhangs were added. The BsaI overhangs are based on Vladimir et al. 2018. CCAA was chosen for upstream and ACGG for downstream. For Gibson assembly, a defined area of homology was designed. BsaI can be used to open the plasmid, removing the reporter and exposing the Gibson overhangs.
+
  
  
Line 49: Line 48:
 
*edited to show relevant bands <br />
 
*edited to show relevant bands <br />
 
</p>''' ]]
 
</p>''' ]]
 +
===Compatibility===
 +
For Golden Gate assembly, BsaI cut sites and defined overhangs were added. The BsaI overhangs are based on Vladimir et al. 2018 [1]. CCAA was chosen for upstream and ACGG for downstream. For Gibson assembly, a defined area of homology was designed. BsaI can be used to open the plasmid, removing the reporter and exposing the Gibson overhangs.
  
  
−
Digesting BioBrick2.0 with BsaI cleaves lacZ so it can be replaced by the insert of interest. As it can be seen on the gel, digestion with both BsaI and EcoRI+PstI is possible.
 
  
  
  
 +
Digesting BioBrick2.0 with BsaI cleaves lacZ so it can be replaced by the insert of interest. As it can be seen on the gel, digestion with both BsaI and EcoRI+PstI is possible.
  
  
Line 80: Line 81:
  
  
−
[[File:File-T--UCL--UCL-BB2-platefig.png|400px|thumb|left|
 
−
<center>'''Figure 3: Representative Plates of BBa_K2842669 cloned into BioBrick2.0'''</center>
 
−
<p>
 
−
(1) Golden Gate Assembly undiluted <br />
 
−
(2) BioBrick Assembly undiluted <br />
 
−
(3) Golden Gate Assembly 10x dilution <br />
 
−
(4) BioBrick Assembly 10x dilution <br />
 
−
(5) Golden Gate Assembly 100x dilution <br />
 
−
(6) BioBrick Assembly 100x dilution <br />
 
−
 
−
</p>''' ]]
 
  
  
Line 96: Line 86:
  
  
 +
[[File:File-T--UCL--FB-RE.png|600px|thumb|center|
 +
<center>'''Figure 2: Restriction enzyme sites on BioBrick2.0'''</center>
  
 +
<p>
 +
(1) EcoRI restriction site for BioBrick Assembly <br />
 +
(2) BsaI restriction site for Golden Gate Assembly <br />
 +
(3) BsaI restriction site for Golden Gate Assembly <br />
 +
(4) PstI restriction site for BioBrick Assembly <br />
 +
</p>''' ]]
  
  
Line 103: Line 101:
  
  
 +
[[File:File-T--UCL--UCL-BB2-platefig.png|400px|thumb|left|
 +
<center>'''Figure 3: Representative Plates of BBa_K2842669 cloned into BioBrick2.0'''</center>
 +
<p>
 +
(1) Golden Gate Assembly undiluted <br />
 +
(2) BioBrick Assembly undiluted <br />
 +
(3) Golden Gate Assembly 10x dilution <br />
 +
(4) BioBrick Assembly 10x dilution <br />
 +
(5) Golden Gate Assembly 100x dilution <br />
 +
(6) BioBrick Assembly 100x dilution <br />
  
 +
</p>''' ]]
 
===Comparison of cloning efficiency between Golden Gate and BioBrick assembly===  
 
===Comparison of cloning efficiency between Golden Gate and BioBrick assembly===  
−
Intein Passenger BBa_K2842669 was cloned into our BioBrick2.0 in pSB1C3 using BioBrick assembly and Golden Gate assembly. The same amount of ligation product was transformed into E. coli DH5α and plated onto LB agar plates containing X-Gal. Ten- and hundred-fold dilutions were carried out to allow an accurate count of colony forming units. A comparison between the average number of blue and white colonies can be seen in the table below. The total number of colonies was similar for the two different cloning techniques. However the ratio between white and blue colonies, indicating how successful cloning was, is higher for Golden Gate cloning. Therefore, our proposed BioBrick2.0 offers a valuable alternative to Biobrick assembly.
+
Intein Passenger BBa_K2842669 was cloned into our BioBrick2.0 in pSB1C3 using BioBrick assembly and Golden Gate assembly. The same amount of ligation product was transformed into NEB competent E. coli DH5α (high efficiency) and plated onto LB Lennox L agar plates containing 20 μg/ml X-Gal. Ten- and hundred-fold dilutions were carried out to allow an accurate count of colony forming units. A comparison between the average number of blue and white colonies can be seen in the table below. The total number of colonies was similar for the two different cloning techniques. However the ratio between white and blue colonies, indicating how successful cloning was, is higher for Golden Gate cloning. Therefore, our proposed BioBrick2.0 offers a valuable alternative to BioBrick assembly.
  
  
Line 172: Line 180:
  
  
 +
===Prefixes===
 +
====Golden Gate: <br />====
 +
Forward overhang: 5'- AAAGGTCTCACCAA -3' <br />
 +
Reverse overhang: 5'- AAAGGTCTCACCGT -3' <br />
  
  
 +
====Gibson:  <br />====
 +
Forward overhang: 5'- GCTTCTACAAACGCGGCTTCTT -3'<br /> 
 +
Reverse overhang: 5'- ACGACGCCGGTTACTACATTGA  -3'<br />
  
  
 +
===Primer Design===
 +
The following primers can be used to amplify the part: <br /> 
 +
Forward: 5'- ACGAACCAGCGATAAGGGACAA -3'<br /> 
 +
Reverse: 5'- TTGGAAGAACGTGGATCTCCCC -3'<br /> 
  
  
−
 
+
===References===
−
 
+
[1] Vladimir P, Ong JL, Kucera RB, Langhorst BW, Bilotti K, Pryor JM, et al. Optimization of Golden Gate assembly through application of ligation sequence-dependent fidelity and bias profiling. bioRxiv [Internet]. 2018 May 15 [cited 2018 Oct 16];322297. Available from: https://www.biorxiv.org/content/early/2018/05/15/322297
−
 
+
−
 
+
  
  

Latest revision as of 01:32, 18 October 2018


Golden Gate compatible system with blue-white screening

Flexible Cloning System
Function Standardised blue-white screening
Use in E. coli cells
Chassis Tested DH5α cells
Abstraction Hierarchy Composite Device
Related Device BBa_I732902
RFC standard RFC10,RFC12,RFC21,RFC23
& RFC25 compatible
Backbone pSB1C3
Submitted by [http://2018.igem.org/Team:UCL UCL iGEM 2018]

This BioBrick-compatible standard with improved flexibility enables the integration of conventional cloning methods into iGEM’s workflow. Once inserted into a backbone, BioBrick2.0 allows cloning through Golden Gate assembly and Gibson assembly. At the same time, our construct has a LacZ reporter which can be used to screen plates for successful colonies. BioBrick2.0 is a new standard which can facilitate the cloning process for future iGEM teams.


Blue-White Screening

The lacZ reporter allows for blue-white screening. It can be displaced by compatible constructs through BioBrick assembly, Golden Gate or Gibson assembly. Blue-white screening is based on the inability of commercial E. coli to metabolise galactose or structurally similar substrates like X-Gal because of a lacZ deletion mutation. Once lacZα is provided through a plasmid, X-Gal can be metabolised to an easily detectable blue compound. This screening can also be used for subsequent cloning where the displacement of lacZ results in white colonies.



Figure 1: Digestion of pSB1C3 BioBrick2.0

(1) BsaI digested BioBrick2.0 (Golden Gate Assembly)
(2) EcoRI+PstI digested BioBrick2.0 (BioBrick Assembly)
(3) undigested BioBrick2.0
*edited to show relevant bands

Compatibility

For Golden Gate assembly, BsaI cut sites and defined overhangs were added. The BsaI overhangs are based on Vladimir et al. 2018 [1]. CCAA was chosen for upstream and ACGG for downstream. For Gibson assembly, a defined area of homology was designed. BsaI can be used to open the plasmid, removing the reporter and exposing the Gibson overhangs.



Digesting BioBrick2.0 with BsaI cleaves lacZ so it can be replaced by the insert of interest. As it can be seen on the gel, digestion with both BsaI and EcoRI+PstI is possible.
















Figure 2: Restriction enzyme sites on BioBrick2.0

(1) EcoRI restriction site for BioBrick Assembly
(2) BsaI restriction site for Golden Gate Assembly
(3) BsaI restriction site for Golden Gate Assembly
(4) PstI restriction site for BioBrick Assembly




Figure 3: Representative Plates of BBa_K2842669 cloned into BioBrick2.0

(1) Golden Gate Assembly undiluted
(2) BioBrick Assembly undiluted
(3) Golden Gate Assembly 10x dilution
(4) BioBrick Assembly 10x dilution
(5) Golden Gate Assembly 100x dilution
(6) BioBrick Assembly 100x dilution

Comparison of cloning efficiency between Golden Gate and BioBrick assembly

Intein Passenger BBa_K2842669 was cloned into our BioBrick2.0 in pSB1C3 using BioBrick assembly and Golden Gate assembly. The same amount of ligation product was transformed into NEB competent E. coli DH5α (high efficiency) and plated onto LB Lennox L agar plates containing 20 μg/ml X-Gal. Ten- and hundred-fold dilutions were carried out to allow an accurate count of colony forming units. A comparison between the average number of blue and white colonies can be seen in the table below. The total number of colonies was similar for the two different cloning techniques. However the ratio between white and blue colonies, indicating how successful cloning was, is higher for Golden Gate cloning. Therefore, our proposed BioBrick2.0 offers a valuable alternative to BioBrick assembly.


CFU Comparison between BioBrick assembly and Golden Gate
Part BBa_K2842666
Cloning Method BioBrick Assembly Golden Gate
Average number of blue colonies 587 313
Average number of white colonies 170 448
Ratio between average number of
white and average number of blue colonies 		0.3 1.4






















Prefixes

Golden Gate:

Forward overhang: 5'- AAAGGTCTCACCAA -3'
Reverse overhang: 5'- AAAGGTCTCACCGT -3'


Gibson:

Forward overhang: 5'- GCTTCTACAAACGCGGCTTCTT -3'
Reverse overhang: 5'- ACGACGCCGGTTACTACATTGA -3'


Primer Design

The following primers can be used to amplify the part:
Forward: 5'- ACGAACCAGCGATAAGGGACAA -3'
Reverse: 5'- TTGGAAGAACGTGGATCTCCCC -3'


References

[1] Vladimir P, Ong JL, Kucera RB, Langhorst BW, Bilotti K, Pryor JM, et al. Optimization of Golden Gate assembly through application of ligation sequence-dependent fidelity and bias profiling. bioRxiv [Internet]. 2018 May 15 [cited 2018 Oct 16];322297. Available from: https://www.biorxiv.org/content/early/2018/05/15/322297


-

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI site found at 647
    Illegal BsaI.rc site found at 28