Difference between revisions of "Part:BBa K2009363"
 
(7 intermediate revisions by 2 users not shown)
Line 2: Line 2:
  
 
<p style="font-weight:bold; font-size:20px;">Sequence And Features</p>
 
<p style="font-weight:bold; font-size:20px;">Sequence And Features</p>
 +
<partinfo>BBa_K2009363</partinfo>
 
<partinfo>BBa_K2009363 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K2009363 SequenceAndFeatures</partinfo>
−
 
+
<br>
 
<p style="font-weight:bold; font-size:20px;">introduction</p>
 
<p style="font-weight:bold; font-size:20px;">introduction</p>
 
<hr>
 
<hr>
Line 12: Line 13:
  
 
We construted this composite parts by ligating two former existing parts and doing a site mutation. The two parts we used is (1) GAL1 promoter Kozak sequence (Part:<html>
 
We construted this composite parts by ligating two former existing parts and doing a site mutation. The two parts we used is (1) GAL1 promoter Kozak sequence (Part:<html>
−
<a href="https://parts.igem.org/PartBBa_J63006"> BBa_J63006</a>
+
<a href="https://parts.igem.org/Part:BBa_J63006"> BBa_J63006</a>
 
</html>) and (2) GFP (Part:Part:<html>
 
</html>) and (2) GFP (Part:Part:<html>
−
<a href="https://parts.igem.org/Part:BBa_E0040"> BBa_E0040</a>
+
<!--<a href="https://parts.igem.org/Part:BBa_E0040"> BBa_E0040</a>-->
 
</html>).
 
</html>).
 +
<partinfo>BBa_E0040</partinfo>
 +
  
 
The GAL1 promoter is activated by the trancription factor GAL4. When GAL4 binds the UAS region, which is on the upstream of the GAL1 promoter, the gene downstream can be expressed. In Yeast-Two-Hybrid (Y2H), GAL4 is divided into two domains, the activating domain (AD) and the binding domain (BD).
 
The GAL1 promoter is activated by the trancription factor GAL4. When GAL4 binds the UAS region, which is on the upstream of the GAL1 promoter, the gene downstream can be expressed. In Yeast-Two-Hybrid (Y2H), GAL4 is divided into two domains, the activating domain (AD) and the binding domain (BD).

Latest revision as of 02:43, 4 October 2016

PGAL+GFP

Sequence And Features

BBa_K2009363


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal AgeI site found at 70
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 1119


introduction


This part is designed as a reporter in the Propri-ontein system of Team USTC 2016.

We construted this composite parts by ligating two former existing parts and doing a site mutation. The two parts we used is (1) GAL1 promoter Kozak sequence (Part: BBa_J63006 ) and (2) GFP (Part:Part: ). BBa_E0040


The GAL1 promoter is activated by the trancription factor GAL4. When GAL4 binds the UAS region, which is on the upstream of the GAL1 promoter, the gene downstream can be expressed. In Yeast-Two-Hybrid (Y2H), GAL4 is divided into two domains, the activating domain (AD) and the binding domain (BD).

The designer of Part: BBa_J63006 is very thoughtful for adding the KOZAK sequence to the downstream of the GAL1 promoter. Apparently, they meaned to improve the effeiciency of this part. However, considering the existence of the Biobrick prefix, the ATG inside the KOZAK sequence won't be in the same reading frame as the ATG of the downstream coding sequence. There were two teams managed to fix this problem, with the idea to eliminate the ATG inside the KOZAK sequence. This year, we applyed a different idea. We added one base pair between those two ATGs and made them belong to one common frame. Meanwhile, another ATG is made up between the former ones, belonging to the same frame.

Part Sequence

CGGATTAGAAGCCGCCGAGCGGGTGACAGCCCTCCGAAGGAAGACTCTCCTCCGTGCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACTAGCTTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATGAACGAATCAAATTAACAACCATAGGATGATAATGCGATTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCGATGATTTTTGATCTATTAACAGATATATAAATGCAAAAACTGCATAACCACTTTAACTAATACTTTCAACATTTTCGGTTTGTATTACTTCTTATTCAAATGTAATAAAAGTATCAACAAAAAATTGTTAATATACCTCTATACTTTAACGTCAAGGAGGAAACTAGACCCGCCGCCACCATGGAGACTATGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAA

(All the sequence has been testified by Sangon)