Difference between revisions of "Part:BBa K4497022"

 
 
(2 intermediate revisions by the same user not shown)
Line 3: Line 3:
 
<partinfo>BBa_K4497022 short</partinfo>
 
<partinfo>BBa_K4497022 short</partinfo>
  
−
v
+
 
 +
This part is one of eight receptor parts that can be used for the the MESA receptor system of the iGEM Team Munich 2022 [https://2022.igem.wiki/munich/results]. The receptors are made of a nanobody receptor for either GFP or mCherry, followed by two different link lengths, and an intracellular domain of either the transcription factor tTA or the protease TEV. tTA is cut off the receptor on contact with the TEV protease. The release of the transcription factor can be used to induce reporters or other expression in the cell of interest.
 +
 
 +
==Design & Cloning==
 +
===Design===
 +
This part specifically is made of the following components:
 +
 
 +
*GFP nanobody receptor ([[Part:BBa_K4497008]])
 +
** IL-11 Signaling Sequence ([[Part:BBa_K4497003]]): Signaling Sequence for Cell surface expression
 +
** Myc-tag ([[Part:BBa_K112502]]): Myc epitope tag that enables surface expression detection using immunofluorescence labeling
 +
** Anti-GFP nanobody ([[Part:BBa_K4497002]]): a nanobody capable of binding GFP
 +
*Membrane linker 2([[Part:BBa_K4497016]]): A short linker between the nanobody and transmembrane domain
 +
*tTA signaling MESA domain ([[Part:BBa_K4497010]])
 +
** CD 28 transmembrane domain ([[Part:BBa_K4497004]]): transmembrane anchor for the MESA system
 +
** TEV Protease Recognition Sequence (M) ([[Part:BBa_K4497006]]): Sequence cut by TEV protease
 +
** Tetracycline-Induced Transactivator tTA ([[Part:BBa_K4497007]]): Transcription factor of our MESA system
 +
** EBFP2 ([[Part:BBa_K511100]]): BFP reporter fused to tTA allowing measuring expression and correction of other linked measurements to MESA surface expression.
 +
 
 +
===Cloning===
 +
We created this part using restriction cloning.
 +
The backbone pcDNA3.4 with the GFP nanobody receptor sequence was created by digesting the plasmid pcDNA3.1-myc-GFPnb-gp130 using XbaI, EcoRI. The plasmid was kindly provided to us from Prof. Scheller [1].
 +
 
 +
The insert containing the membrane linker and tTA signaling MESA domain was created by PCR on the plasmid V2-MESA-35F-M-tTA (Addgene #84502 [2]). The PCR product was digested using XbaI, EcoRI before ligation and transformation into ''E.coli''.
 +
* Primer F: TAAGCAGAATTCGGAGGAGACTACAAGGACGATG 
 +
* Primer R: TAAGCATCTAGATTACTTGTACAGCTCGTCCATG 
 +
 
 +
==MESA System==
 +
Please find an in-depth analysis of the usage of this part at the page of MESA GFPnb-L1-tTA: [[Part:BBa_K4497017]]
 +
 
 +
These are all the MESA parts:
 +
*G1TA: [[Part:BBa_K4497017]]
 +
*G1TEV: [[Part:BBa_K4497018]]
 +
*M1TA: [[Part:BBa_K4497019]]
 +
*M1TEV: [[Part:BBa_K4497020]]
 +
*G2TA: [[Part:BBa_K4497021]]
 +
*G2TEV: [[Part:BBa_K4497022]]
 +
*M2TA: [[Part:BBa_K4497023]]
 +
*M2TEV: [[Part:BBa_K4497024]]
 +
 
 +
=== Usage and Biology===
 +
We used this part in mammalian cell culture: HEK293T, Cos7 in a S1 safety level lab.
 +
 
 +
 
  
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here
Line 11: Line 53:
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>
 
<partinfo>BBa_K4497022 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K4497022 SequenceAndFeatures</partinfo>
 +
===References===
 +
[1] Mossner, S., Phan, H. T., Triller, S., Moll, J. M., Conrad, U., & Scheller, J. (2020). Multimerization strategies for efficient production and purification of highly active synthetic cytokine receptor ligands. PLOS ONE, 15(4), e0230804.
 +
 +
[2]  Rewiring human cellular input-output using modular extracellular sensors. Schwarz KA, Daringer NM, Dolberg TB, Leonard JN. Nat Chem Biol. 2016 Dec 12. doi: 10.1038/nchembio.2253. 10.1038/nchembio.2253 PubMed 27941759
 +
  
  

Latest revision as of 13:43, 13 October 2022


MESA GFPnb-L2-TEV


This part is one of eight receptor parts that can be used for the the MESA receptor system of the iGEM Team Munich 2022 [1]. The receptors are made of a nanobody receptor for either GFP or mCherry, followed by two different link lengths, and an intracellular domain of either the transcription factor tTA or the protease TEV. tTA is cut off the receptor on contact with the TEV protease. The release of the transcription factor can be used to induce reporters or other expression in the cell of interest.

Design & Cloning

Design

This part specifically is made of the following components:

  • GFP nanobody receptor (Part:BBa_K4497008)
    • IL-11 Signaling Sequence (Part:BBa_K4497003): Signaling Sequence for Cell surface expression
    • Myc-tag (Part:BBa_K112502): Myc epitope tag that enables surface expression detection using immunofluorescence labeling
    • Anti-GFP nanobody (Part:BBa_K4497002): a nanobody capable of binding GFP
  • Membrane linker 2(Part:BBa_K4497016): A short linker between the nanobody and transmembrane domain
  • tTA signaling MESA domain (Part:BBa_K4497010)
    • CD 28 transmembrane domain (Part:BBa_K4497004): transmembrane anchor for the MESA system
    • TEV Protease Recognition Sequence (M) (Part:BBa_K4497006): Sequence cut by TEV protease
    • Tetracycline-Induced Transactivator tTA (Part:BBa_K4497007): Transcription factor of our MESA system
    • EBFP2 (Part:BBa_K511100): BFP reporter fused to tTA allowing measuring expression and correction of other linked measurements to MESA surface expression.

Cloning

We created this part using restriction cloning. The backbone pcDNA3.4 with the GFP nanobody receptor sequence was created by digesting the plasmid pcDNA3.1-myc-GFPnb-gp130 using XbaI, EcoRI. The plasmid was kindly provided to us from Prof. Scheller [1].

The insert containing the membrane linker and tTA signaling MESA domain was created by PCR on the plasmid V2-MESA-35F-M-tTA (Addgene #84502 [2]). The PCR product was digested using XbaI, EcoRI before ligation and transformation into E.coli.

  • Primer F: TAAGCAGAATTCGGAGGAGACTACAAGGACGATG
  • Primer R: TAAGCATCTAGATTACTTGTACAGCTCGTCCATG

MESA System

Please find an in-depth analysis of the usage of this part at the page of MESA GFPnb-L1-tTA: Part:BBa_K4497017

These are all the MESA parts:

Usage and Biology

We used this part in mammalian cell culture: HEK293T, Cos7 in a S1 safety level lab.


Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal EcoRI site found at 454
    Illegal SpeI site found at 988
    Illegal PstI site found at 349
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal EcoRI site found at 454
    Illegal SpeI site found at 988
    Illegal PstI site found at 349
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal EcoRI site found at 454
    Illegal BamHI site found at 103
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal EcoRI site found at 454
    Illegal SpeI site found at 988
    Illegal PstI site found at 349
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal EcoRI site found at 454
    Illegal SpeI site found at 988
    Illegal PstI site found at 349
    Illegal AgeI site found at 535
  • 1000
    COMPATIBLE WITH RFC[1000]

References

[1] Mossner, S., Phan, H. T., Triller, S., Moll, J. M., Conrad, U., & Scheller, J. (2020). Multimerization strategies for efficient production and purification of highly active synthetic cytokine receptor ligands. PLOS ONE, 15(4), e0230804.

[2] Rewiring human cellular input-output using modular extracellular sensors. Schwarz KA, Daringer NM, Dolberg TB, Leonard JN. Nat Chem Biol. 2016 Dec 12. doi: 10.1038/nchembio.2253. 10.1038/nchembio.2253 PubMed 27941759