Difference between revisions of "Part:BBa K4497017"
 
(One intermediate revision by the same user not shown)
Line 22: Line 22:
 
===Cloning===
 
===Cloning===
 
We created this part using restriction cloning.
 
We created this part using restriction cloning.
−
The backbone pcDNA3.4 with the GFP nanobody receptor sequence was created by digesting the plasmid pcDNA3.1-SP-Flag HA-Tag-mCherrynb-gp130 using XbaI, EcoRI. The plasmid was kindly provided to us from Prof. Scheller [1].
+
The backbone pcDNA3.4 with the GFP nanobody receptor sequence was created by digesting the plasmid pcDNA3.1-myc-GFPnb-gp130 using XbaI, EcoRI. The plasmid was kindly provided to us from Prof. Scheller [1].
  
 
The insert containing the membrane linker and tTA signaling MESA domain was created by PCR on the plasmid V2-MESA-35F-M-tTA (Addgene #84502 [2]). The PCR product was digested using XbaI, EcoRI before ligation and transformation into ''E.coli''.
 
The insert containing the membrane linker and tTA signaling MESA domain was created by PCR on the plasmid V2-MESA-35F-M-tTA (Addgene #84502 [2]). The PCR product was digested using XbaI, EcoRI before ligation and transformation into ''E.coli''.
Line 50: Line 50:
 
To test our MESA part functionality, we designed a simple test system, using one of the three ligands, a fitting MESA pair and a tTA-inducable reporter system (Fig.2).
 
To test our MESA part functionality, we designed a simple test system, using one of the three ligands, a fitting MESA pair and a tTA-inducable reporter system (Fig.2).
  
−
[[File:MUC Loop simple.png|800px]]
+
[[File:MUC Loop simple.png|600px]]
  
 
'''Figure 2. MESA Testing Setup.''' Our first tests employed EYFP ([[Part:BBa_K4497028]]) or miRFP ([[Part:BBa_K4497030]]) as an inducible reporter for the transcription factor. The ligand is added manually to the cells.
 
'''Figure 2. MESA Testing Setup.''' Our first tests employed EYFP ([[Part:BBa_K4497028]]) or miRFP ([[Part:BBa_K4497030]]) as an inducible reporter for the transcription factor. The ligand is added manually to the cells.
  
−
We tested whether our MESA components are expressed and whether they are capable of ligand binding. We therefore transfected HEK293T cells with only one MESA part. Cells without any MESA part with and without added ligand were used as a control. To all MESA component cell samples ligand was added. As shown in Figure 4, Cells containing a MESA part show a significantly higher signal than those who do not. This indicates a low to no retention of ligand on the cell surface in the absence of receptors. On transfection of the receptors, the corresponding fluorescence signals increase by a factor of at least 1.5 indicating both the expression on the cell surface and ligand binding. The exception here is G1TEV MESA showing no significant binding.  
+
We tested whether our MESA components are expressed and whether they are capable of ligand binding. We therefore transfected HEK293T cells with only one MESA part. Cells without any MESA part with and without added ligand were used as a control. To all MESA component cell samples ligand was added. As shown in Figure 3, Cells containing a MESA part show a significantly higher signal than those who do not. This indicates a low to no retention of ligand on the cell surface in the absence of receptors. On transfection of the receptors, the corresponding fluorescence signals increase by a factor of at least 1.5 indicating both the expression on the cell surface and ligand binding. The exception here is G1TEV MESA showing no significant binding.  
  
−
[[File:MUC binding.png|800px]]
+
[[File:MUC binding.png|700px]]
 +
 
 +
'''Figure 3. GFP and mCherry fluorescence signals of mCherry (A) and GFP MESA  (B) components in HEK293T cells.''' The Mean Fluorescence Intensity (MFI) of mCherry and GFP was obtained of at least 30000 cells per sample. MFI was calculated using the geometric mean. Control- & Control+: MFI of cells containing no MESA parts, without and with added ligand. MFI of cells containing one MESA part: mCherry MESA (A) or GFP (B), Transcriptionfactor (TF), TEV polymerase (TEV) with linkers 1 or 2 and added ligand.
  
−
Figure 4. GFP and mCherry fluorescence signals of mCherry (A) and GFP MESA  (B) components in HEK293T cells. The Mean Fluorescence Intensity (MFI) of mCherry and GFP was obtained of at least 30000 cells per sample. MFI was calculated using the geometric mean. Control- & Control+: MFI of cells containing no MESA parts, without and with added ligand. MFI of cells containing one MESA part: mCherry MESA (A) or GFP (B), Transcriptionfactor (TF), TEV polymerase (TEV) with linkers 1 or 2 and added ligand.
 
 
We tested all the possible combinations of two of our MESA system, inducing them with the corresponding synthetic ligand dimer (2xmCherry, 2xGFP or GFP-mCherry). The activation of each receptor pair was measured using our tTA inducable miRFP680 reporter ([[Part:BBa_K4497030]]) (Fig. 4)  
 
We tested all the possible combinations of two of our MESA system, inducing them with the corresponding synthetic ligand dimer (2xmCherry, 2xGFP or GFP-mCherry). The activation of each receptor pair was measured using our tTA inducable miRFP680 reporter ([[Part:BBa_K4497030]]) (Fig. 4)  
  
 
[[File:MUC MESA.png|800px]]
 
[[File:MUC MESA.png|800px]]
  
−
Figure 4. Reporter activation of the MESA system upon ligand binding in HEK293T cells. Different MESA component combinations were tested without (blue) and with (red) ligand addition, M1TA M1TEV (A), M2TA M2TEV (B), G1TA G1TEV (C), G2TA G2TEV (D), M1TA G1TEV (E), G1TA M1TEV (F), M2TA G2TEV (G), G2TA M2TEV (H). For each combination three transfection ratios of TF to TEV were tested: 6x, 12x and 24x. The APC signal was corrected by dividing APC MFI (Median) by the BFP MFI (Median) of each sample. Ligand was added 24 h after transfection, cytometer measurements were performed 48 h after transfection. Bar plots show the median of one sample with a total of at least 3000 APC positive gated events counted.
+
'''Figure 4. Reporter activation of the MESA system upon ligand binding in HEK293T cells.''' Different MESA component combinations were tested without (blue) and with (red) ligand addition, M1TA M1TEV (A), M2TA M2TEV (B), G1TA G1TEV (C), G2TA G2TEV (D), M1TA G1TEV (E), G1TA M1TEV (F), M2TA G2TEV (G), G2TA M2TEV (H). For each combination three transfection ratios of TF to TEV were tested: 6x, 12x and 24x. The APC signal was corrected by dividing APC MFI (Median) by the BFP MFI (Median) of each sample. Ligand was added 24 h after transfection, cytometer measurements were performed 48 h after transfection. Bar plots show the median of one sample with a total of at least 3000 APC positive gated events counted.
  
 
Unfortunately, none of the screened MESA combinations show a significant increase in reporter signaling on ligand addition. Schwarz et al. [3] showed reporter induction of 2x and more for their best MESA combinations. It might be that our chosen incubation times, both before adding ligand and before measuring are not optimal. It might be that the cells need more or less time with or without ligand to give a better signal differentiation. Additionally, we might not have screened the optimal plasmid ratios or created suboptimal linker lengths. A more broad screen with more constructs might reveal an optimal condition that we missed. It has to be added that the shown cytometry analysis results only resemble one transfection sample, so one biological replicate. While this is not enough for obtaining significant results, we were hoping to find a promising MESA component and ligand combination in this scanning experiment.  
 
Unfortunately, none of the screened MESA combinations show a significant increase in reporter signaling on ligand addition. Schwarz et al. [3] showed reporter induction of 2x and more for their best MESA combinations. It might be that our chosen incubation times, both before adding ligand and before measuring are not optimal. It might be that the cells need more or less time with or without ligand to give a better signal differentiation. Additionally, we might not have screened the optimal plasmid ratios or created suboptimal linker lengths. A more broad screen with more constructs might reveal an optimal condition that we missed. It has to be added that the shown cytometry analysis results only resemble one transfection sample, so one biological replicate. While this is not enough for obtaining significant results, we were hoping to find a promising MESA component and ligand combination in this scanning experiment.  

Latest revision as of 13:18, 13 October 2022


MESA GFPnb-L1-tTA

This part is one of eight receptor parts that can be used for the the MESA receptor system of the iGEM Team Munich 2022 [1]. The receptors are made of a nanobody receptor for either GFP or mCherry, followed by two different link lengths, and an intracellular domain of either the transcription factor tTA or the protease TEV. tTA is cut off the receptor on contact with the TEV protease. The release of the transcription factor can be used to induce reporters or other expression in the cell of interest.

Design & Cloning

Design

This part specifically is made of the following components:

  • GFP nanobody receptor (Part:BBa_K4497008)
    • IL-11 Signaling Sequence (Part:BBa_K4497003): Signaling Sequence for Cell surface expression
    • Myc-tag (Part:BBa_K112502): Myc epitope tag that enables surface expression detection using immunofluorescence labeling
    • Anti-GFP nanobody (Part:BBa_K4497002): a nanobody capable of binding GFP
  • Membrane linker (Part:BBa_K4497015): A short linker between the nanobody and transmembrane domain
  • tTA signaling MESA domain (Part:BBa_K4497010)
    • CD 28 transmembrane domain (Part:BBa_K4497004): transmembrane anchor for the MESA system
    • TEV Protease Recognition Sequence (M) (Part:BBa_K4497006): Sequence cut by TEV protease
    • Tetracycline-Induced Transactivator tTA (Part:BBa_K4497007): Transcription factor of our MESA system
    • EBFP2 (Part:BBa_K511100): BFP reporter fused to tTA allowing measuring expression and correction of other linked measurements to MESA surface expression.

Cloning

We created this part using restriction cloning. The backbone pcDNA3.4 with the GFP nanobody receptor sequence was created by digesting the plasmid pcDNA3.1-myc-GFPnb-gp130 using XbaI, EcoRI. The plasmid was kindly provided to us from Prof. Scheller [1].

The insert containing the membrane linker and tTA signaling MESA domain was created by PCR on the plasmid V2-MESA-35F-M-tTA (Addgene #84502 [2]). The PCR product was digested using XbaI, EcoRI before ligation and transformation into E.coli.

  • Primer F: TAAGCAGAATTCTCCGGCGGGAATCTGGTCGTGGTTGCTGGAG
  • Primer R: TAAGCATCTAGATTACTTGTACAGCTCGTCCATG

MESA System

MESA System Overview

In our MESA system two complementing parts are combined to achieve a ligand induced release of tTA to allow induction of a chosen gene (Fig.1). When an expressed MESA part containing tTA with a part containing the protease TEV, tTA is cut of and released to the nucleus, where it can affect expression on chosen (reporter) proteins. Depending on the chosen combination the ligand binding to it is the homodimer mCherry-Fc (Part:BBa_K4497038) , GFP-Fc (Part:BBa_K4497037) or the heterodimer GFP-mCherry-Fc (Part:BBa_K4497039).


MUC combis.png

Figure 1. Overview over Possible Combinations of MESA System. (A): Our designs incorporate two different nanobodies against mCherry (M) and GFP (G). Two different linker lengths to the transmembrane domain were created 1 (SEFSGGN) and 2 (SEFGGDYKDDDDNGGSGGSGGSGGSGGGTG). Finally, two different internal functions can be used: Protease (TEV), Transcription Factor tTA (TA). This leads to 8 different combinations in total: M1TA, M1TEV, M2TA, M2TEV, G1TA, G1TEV, G2TA, G2TEV. (B) Two examples for possible combination - left: homodimeric combination M1TA & M1TEV - right: heterodimeric combination M1TA & G1TEV.

These are all the MESA parts:

Data

To test our MESA part functionality, we designed a simple test system, using one of the three ligands, a fitting MESA pair and a tTA-inducable reporter system (Fig.2).

MUC Loop simple.png

Figure 2. MESA Testing Setup. Our first tests employed EYFP (Part:BBa_K4497028) or miRFP (Part:BBa_K4497030) as an inducible reporter for the transcription factor. The ligand is added manually to the cells.

We tested whether our MESA components are expressed and whether they are capable of ligand binding. We therefore transfected HEK293T cells with only one MESA part. Cells without any MESA part with and without added ligand were used as a control. To all MESA component cell samples ligand was added. As shown in Figure 3, Cells containing a MESA part show a significantly higher signal than those who do not. This indicates a low to no retention of ligand on the cell surface in the absence of receptors. On transfection of the receptors, the corresponding fluorescence signals increase by a factor of at least 1.5 indicating both the expression on the cell surface and ligand binding. The exception here is G1TEV MESA showing no significant binding.

MUC binding.png

Figure 3. GFP and mCherry fluorescence signals of mCherry (A) and GFP MESA (B) components in HEK293T cells. The Mean Fluorescence Intensity (MFI) of mCherry and GFP was obtained of at least 30000 cells per sample. MFI was calculated using the geometric mean. Control- & Control+: MFI of cells containing no MESA parts, without and with added ligand. MFI of cells containing one MESA part: mCherry MESA (A) or GFP (B), Transcriptionfactor (TF), TEV polymerase (TEV) with linkers 1 or 2 and added ligand.

We tested all the possible combinations of two of our MESA system, inducing them with the corresponding synthetic ligand dimer (2xmCherry, 2xGFP or GFP-mCherry). The activation of each receptor pair was measured using our tTA inducable miRFP680 reporter (Part:BBa_K4497030) (Fig. 4)

MUC MESA.png

Figure 4. Reporter activation of the MESA system upon ligand binding in HEK293T cells. Different MESA component combinations were tested without (blue) and with (red) ligand addition, M1TA M1TEV (A), M2TA M2TEV (B), G1TA G1TEV (C), G2TA G2TEV (D), M1TA G1TEV (E), G1TA M1TEV (F), M2TA G2TEV (G), G2TA M2TEV (H). For each combination three transfection ratios of TF to TEV were tested: 6x, 12x and 24x. The APC signal was corrected by dividing APC MFI (Median) by the BFP MFI (Median) of each sample. Ligand was added 24 h after transfection, cytometer measurements were performed 48 h after transfection. Bar plots show the median of one sample with a total of at least 3000 APC positive gated events counted.

Unfortunately, none of the screened MESA combinations show a significant increase in reporter signaling on ligand addition. Schwarz et al. [3] showed reporter induction of 2x and more for their best MESA combinations. It might be that our chosen incubation times, both before adding ligand and before measuring are not optimal. It might be that the cells need more or less time with or without ligand to give a better signal differentiation. Additionally, we might not have screened the optimal plasmid ratios or created suboptimal linker lengths. A more broad screen with more constructs might reveal an optimal condition that we missed. It has to be added that the shown cytometry analysis results only resemble one transfection sample, so one biological replicate. While this is not enough for obtaining significant results, we were hoping to find a promising MESA component and ligand combination in this scanning experiment.

Usage and Biology

We used all MESA parts in mammalian cell culture: HEK293T, Cos7 in a S1 safety level lab.

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal EcoRI site found at 454
    Illegal XbaI site found at 559
    Illegal PstI site found at 349
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal EcoRI site found at 454
    Illegal PstI site found at 349
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal EcoRI site found at 454
    Illegal BamHI site found at 103
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal EcoRI site found at 454
    Illegal XbaI site found at 559
    Illegal PstI site found at 349
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal EcoRI site found at 454
    Illegal XbaI site found at 559
    Illegal PstI site found at 349
  • 1000
    COMPATIBLE WITH RFC[1000]

References

[1] Mossner, S., Phan, H. T., Triller, S., Moll, J. M., Conrad, U., & Scheller, J. (2020). Multimerization strategies for efficient production and purification of highly active synthetic cytokine receptor ligands. PLOS ONE, 15(4), e0230804.

[2] Rewiring human cellular input-output using modular extracellular sensors. Schwarz KA, Daringer NM, Dolberg TB, Leonard JN. Nat Chem Biol. 2016 Dec 12. doi: 10.1038/nchembio.2253. 10.1038/nchembio.2253 PubMed 27941759


[3] Schwarz, K. A., Daringer, N. M., Dolberg, T. B., Leonard, J. N. (2017). Rewiring human cellular input-output using modular extracellular sensors. Nature Chemical Biology>, 13(2), 202–209. https://doi.org/10.1038/nchembio.2253