Difference between revisions of "Part:BBa K4197014"
 
(4 intermediate revisions by the same user not shown)
Line 2: Line 2:
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K4197014 short</partinfo>
 
<partinfo>BBa_K4197014 short</partinfo>
−
<span class='h3bb'>Sequence and Features</span>
+
 
−
<partinfo>BBa_K4197014 SequenceAndFeatures</partinfo>
+
Constitutive promoter for <i>E. coli</i>.
  
 
<html>
 
<html>
  
 
<h2>Introduction</h2>
 
<h2>Introduction</h2>
−
<p>Xxxxx xxxxx xxxxx xxxxxx xxxx</p>
+
<p>This part is composed of the gene coding for the 800 first base pairs of the <i>ihfB</i> promoter. This promoter has been identified as a constitutive <i>E. coli</i> promoter (Weglenska et al., 1996). It was used for constitutive expression of fluorescent proteins in <i>E. coli</i> (Barthe et al., 2020) and appears as strong enough to permit sufficient expression without inclusion bodies.</p>
  
 
<h2>Construction</h2>
 
<h2>Construction</h2>
−
<p>Xxxxx xxxxx xxxxx xxxxxx xxxx</p>
 
−
   
 
−
 
−
<div class="center">
 
−
        <div class="thumb tnone">
 
−
            <div class="thumbinner" style="width:50%;">
 
−
                <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="image">
 
−
                    <img alt="" src="/wiki/images/7/7e/T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
 
−
                    <div class="magnify">
 
−
                        <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="internal" title="Enlarge"></a>
 
−
                    </div>
 
−
                    <b>Figure 1: </b> <b>Xxxxxx</b> 
 
−
                  Xxxxxxxxxxxxxxxxxxxxxxxxxxx.
 
−
                </div>
 
−
            </div>
 
−
        </div>
 
−
    </div>
 
−
<h2>Xxxxxxxxx</h2>
 
−
<p>Xxxxxxxxxxxxx</p>
 
−
<div class="center">
 
−
    <div class="thumb tnone">
 
−
        <div class="thumbinner" style="width:80%;">
 
−
            <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" class="image">
 
−
                <img alt="" src="https://static.igem.org/mediawiki/2018/5/5b/T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
 
−
                <div class="magnify">
 
−
                    <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" class="internal" title="Enlarge"></a>
 
−
                </div>
 
−
                <b>Figure 2: </b> <b>Xxxxxxxxxxxxx</b> 
 
−
                Xxxxxxxxxxxxx.
 
−
            </div>
 
−
        </div>
 
−
    </div>
 
−
</div>
 
−
   
 
−
<h2>titre 2</h2>
 
−
<h3>Titre 3</h3>
 
−
<p>Xxxxxxxxxx</p>
 
−
<ul>
 
−
    <li>Forward : TAAGAAGGAGATATACCATGGCGGAAGCGGGTATCACC</li>
 
−
    <li>Reverse : CTCGAGTGCGGCCGCAAGCTTCGGATCGTCCTATGATGGAGG</li>
 
−
</ul>
 
−
<p>Xxxxxxxxxx</p>
 
−
<ul>
 
−
    <li>CForward : CGCGGCCGCTTCTAGAGCGGAAGCGGGTATCACC</li>
 
−
    <li>Reverse : AGCGGCCGCTACTAGTCGGATCGTCCTATGATGGAGG</li>
 
−
</ul>
 
−
 
−
 
−
<h3>titre 3</h3>
 
−
    <h4>Titre 4</h4>
 
−
<p>Xxxxxx</p>
 
  
−
                 
+
<p>The objective of the INSA-UPS 2022 team was to use the ihfB800 promoter to express mTagBFP (<a href="https://parts.igem.org/Part:BBa_K4197013">BBa_K4197013</a>), mRFP1 (<a href="https://parts.igem.org/Part:BBa_K4197012">BBa_K4197012</a>), and mScarlet-I (<a href="https://parts.igem.org/Part:BBa_K4197022">BBa_K4197022</a>) into <i>E. coli</i> Tuner (DE3) cells. The functionality of the promoter was confirmed as the mTagBFP and mScarlet-I were successfully expressed (see <a href="https://parts.igem.org/Part:BBa_K4197001">BBa_K4197001</a> and <a href="https://parts.igem.org/Part:BBa_K4197021">BBa_K4197021</a> respectively).</p>
−
<h4>Titre 4</h4>
+
                                             
−
<p>xxxxxxx</p>
+
<h2>Conclusion</h2>
 +
<p>We found that this promoter is very efficient for constitutive expression in <i>E. coli</i>. Do not hesitate to use it for your experimentations.</p>
  
−
<h2>Titre 2</h2>
 
−
<p>Xxxxxx</p>
 
 
<h2>References</h2>
 
<h2>References</h2>
 +
<p>More information about the project for which the part was created:<a href="https://2022.igem.wiki/toulouse-insa-ups/index.html"> DAISY (INSA-UPS 2022)</a> </p>
 
<ol>
 
<ol>
 
     <i>
 
     <i>
−
     <li>Morag E, Lapidot A, Govorko D, Lamed R, Wilchek M, Bayer EA, Shoham Y: Expression, purification, and characterization of the cellulose-binding domain of the scaffoldin subunit from the cellulosome of Clostridium thermocellum. Applied and Environmental Microbiology 1995, 61:1980-1986.</li>
+
     <li>Wȩgleńska, A., Jacob, B., & Sirko, A. (1996). Transcriptional pattern of Escherichia coli ihfB (himD) gene expression. Gene, 181(1-2), 85–88. https://doi.org/10.1016/s0378-1119(96)00468-4</li>
−
     <li>Nogueira ES, Schleier T, Durrenberger M, Ballmer-Hofer K, Ward TR, Jaussi R: High-level secretion of recombinant full-length streptavidin in Pichia pastoris and its application to enantioselective catalysis. Protein Expr Purif 2014, 93:54-62. DOI: 10.1016/j.pep.2013.10.015.</li>
+
     <li>Barthe, M., Tchouanti, J., Gomes, P. H., Bideaux, C., Lestrade, D., Graham, C., Steyer, J.-P., Meleard, S., Harmand, J., Gorret, N., Cocaign-Bousquet, M., & Enjalbert, B. (2020). Availability of the Molecular Switch XylR Controls Phenotypic Heterogeneity and Lag Duration during Escherichia coli Adaptation from Glucose to Xylose. mBio, 11(6), Article e02938-20. https://doi.org/10.1128/mbio.02938-20</i>
−
    <li>Young TS, Schultz PG: Beyond the canonical 20 amino acids: expanding the genetic lexicon. J Biol Chem 2010, 285:11039-11044. DOI: 10.1074/jbc.R109.091306.</li>
+
−
</i>
+
 
</ol>
 
</ol>
 
</html>
 
</html>

Latest revision as of 17:44, 8 October 2022


ihfB800 promoter

Constitutive promoter for E. coli.

Introduction

This part is composed of the gene coding for the 800 first base pairs of the ihfB promoter. This promoter has been identified as a constitutive E. coli promoter (Weglenska et al., 1996). It was used for constitutive expression of fluorescent proteins in E. coli (Barthe et al., 2020) and appears as strong enough to permit sufficient expression without inclusion bodies.

Construction

The objective of the INSA-UPS 2022 team was to use the ihfB800 promoter to express mTagBFP (BBa_K4197013), mRFP1 (BBa_K4197012), and mScarlet-I (BBa_K4197022) into E. coli Tuner (DE3) cells. The functionality of the promoter was confirmed as the mTagBFP and mScarlet-I were successfully expressed (see BBa_K4197001 and BBa_K4197021 respectively).

Conclusion

We found that this promoter is very efficient for constitutive expression in E. coli. Do not hesitate to use it for your experimentations.

References

More information about the project for which the part was created: DAISY (INSA-UPS 2022)

  1. Wȩgleńska, A., Jacob, B., & Sirko, A. (1996). Transcriptional pattern of Escherichia coli ihfB (himD) gene expression. Gene, 181(1-2), 85–88. https://doi.org/10.1016/s0378-1119(96)00468-4
  2. Barthe, M., Tchouanti, J., Gomes, P. H., Bideaux, C., Lestrade, D., Graham, C., Steyer, J.-P., Meleard, S., Harmand, J., Gorret, N., Cocaign-Bousquet, M., & Enjalbert, B. (2020). Availability of the Molecular Switch XylR Controls Phenotypic Heterogeneity and Lag Duration during Escherichia coli Adaptation from Glucose to Xylose. mBio, 11(6), Article e02938-20. https://doi.org/10.1128/mbio.02938-20

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
    Illegal AgeI site found at 329
  • 1000
    COMPATIBLE WITH RFC[1000]