Difference between revisions of "Part:BBa K515007"

 
 
(18 intermediate revisions by 5 users not shown)
Line 1: Line 1:
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K515007 short</partinfo>
 
<partinfo>BBa_K515007 short</partinfo>
  
atgaacctcatcaaagaggatatgcgcgtaaaagtccacatggaaggcaacgtgaatggtcatgcgttcgtaatcgaagg tgaaggcaaagggaaaccgtacgaaggtacgcaaactgcaaacttgaccgtgaaagaaggtgcacctctgccattcagct acgacattcttaccactgcggttcactatggcaatcgtgtctttacgaaatatccggaagatattccggactacttcaaa cagtcgtttccggaaggctattcatgggagcgtaccatgacctttgaggataaaggcatttgcacaattcgcagcgatat tagcctggaaggggactgcttctttcagaacgttcggtttaaaggcacgaattttcctccgaatgggccggttatgcaga agaaaaccctgaaatgggaaccgtcgacagagaaactgcatgtgcgtgatggacttctggtcggtaacatcaacatggcc ttactgttggaaggtggaggccattatctctgtgacttcaaaaccacgtataaggcgaagaaagtggtacagctgccaga tgcccactttgtggatcatcgcatcgaaattctgggcaatgactccgattacaacaaagtcaagctgtacgagcatgctg ttgctcgctatagtcccttaccctctcaagtgtggtgataa
 
  
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here
Line 13: Line 11:
  
  
<!-- Uncomment this to enable Functional Parameter display
+
 
===Functional Parameters===
+
<html>
 +
 
 +
 
 +
 
 +
<p><b>This BioBrick has been sequence verified.</b></p>
 +
<p><b>For the full characterisation of the device, please refer to the <a href="https://parts.igem.org/wiki/index.php?title=Part:BBa_K515107"><b>BBa_K515107</b></a> page.</b>
 +
 
 +
 
 +
<h2>Description</h2>
 +
<p>This part consists of the Dendra2 coding sequence codon optimised for <i>Escherichia coli</i>. It is part of the composite BioBrick <a href="https://parts.igem.org/Part:BBa_K515107">BBa_K515107</a>. This sequence codes for the photoconvertible protein Dendra2, capable of being irreversibly photoconverted from excitation at 486nm and emission at 505nm wavelength to 558nm excitation and 575nm emission wavelength. Photoconversion can occur using two wavelengths, 488 and 405nm<sup>[1]</sup>.</p>
 +
 
 +
</html>
 +
 
 +
 
 +
 
 +
 
 +
==Functional Parameters: Austin_UTexas==
 +
<html>
 +
<body>
 
<partinfo>BBa_K515007 parameters</partinfo>
 
<partinfo>BBa_K515007 parameters</partinfo>
<!-- -->
+
<h3><center>Burden Imposed by this Part:</center></h3>
 +
<figure>
 +
<div class = "center">
 +
<center><img src = "https://static.igem.org/mediawiki/parts/f/fa/T--Austin_Utexas--no_burden_icon.png" style = "width:160px;height:120px"></center>
 +
</div>
 +
<figcaption><center><b>Burden Value: 0.2 ± 5.3% </b></center></figcaption>
 +
</figure>
 +
<p> Burden is the percent reduction in the growth rate of <i>E. coli</i> cells transformed with a plasmid containing this BioBrick (± values are 95% confidence limits). This BioBrick did not exhibit a burden that was significantly greater than zero (i.e., it appears to have little to no impact on growth). Therefore, users can depend on this part to remain stable for many bacterial cell divisions and in large culture volumes. Refer to any one of the
 +
<a href="https://parts.igem.org/Part:BBa_K3174002">BBa_K3174002</a> - <a href="https://parts.igem.org/Part:BBa_K3174007">BBa_K3174007</a> pages for more information on the methods, an explanation of the sources of burden,  and other conclusions from a large-scale measurement project conducted by the <a href="http://2019.igem.org/Team:Austin_UTexas">2019 Austin_UTexas team</a>.</p>
 +
<p>This functional parameter was added by the <a href="https://2020.igem.org/Team:Austin_UTexas/Contribution">2020 Austin_UTexas team.</a></p>
 +
</body>
 +
</html>
 +
 
 +
 
 +
 
 +
<h2>References</h2>
 +
[1] Gurskaya N et al. (2006) Engineering of a monomeric green-to-red photoactivatable fluorescent protein induced by blue light. Nature Biotechnology 24: 461-465.
 +
</html>

Latest revision as of 03:34, 26 August 2020

Dendra2


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


This BioBrick has been sequence verified.

For the full characterisation of the device, please refer to the BBa_K515107 page.

Description

This part consists of the Dendra2 coding sequence codon optimised for Escherichia coli. It is part of the composite BioBrick BBa_K515107. This sequence codes for the photoconvertible protein Dendra2, capable of being irreversibly photoconverted from excitation at 486nm and emission at 505nm wavelength to 558nm excitation and 575nm emission wavelength. Photoconversion can occur using two wavelengths, 488 and 405nm[1].



Functional Parameters: Austin_UTexas

BBa_K515007 parameters

Burden Imposed by this Part:

Burden Value: 0.2 ± 5.3%

Burden is the percent reduction in the growth rate of E. coli cells transformed with a plasmid containing this BioBrick (± values are 95% confidence limits). This BioBrick did not exhibit a burden that was significantly greater than zero (i.e., it appears to have little to no impact on growth). Therefore, users can depend on this part to remain stable for many bacterial cell divisions and in large culture volumes. Refer to any one of the BBa_K3174002 - BBa_K3174007 pages for more information on the methods, an explanation of the sources of burden, and other conclusions from a large-scale measurement project conducted by the 2019 Austin_UTexas team.

This functional parameter was added by the 2020 Austin_UTexas team.


References

[1] Gurskaya N et al. (2006) Engineering of a monomeric green-to-red photoactivatable fluorescent protein induced by blue light. Nature Biotechnology 24: 461-465. </html>