Difference between revisions of "Part:BBa K1150039"

 
(7 intermediate revisions by 3 users not shown)
Line 1: Line 1:
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K1150039 short</partinfo>
 
<partinfo>BBa_K1150039 short</partinfo>
 +
  
 
{| style="color:black" cellpadding="6" cellspacing="1" border="2" align="right"
 
{| style="color:black" cellpadding="6" cellspacing="1" border="2" align="right"
! colspan="2" style="background:#FFBF00;"|COP1
+
! colspan="2" style="background:#FFBF00;"|RNAimer (VEGF4 target)
 
|-
 
|-
 
|'''Function'''
 
|'''Function'''
|interaction partner of
+
|Targeting VEGF4 with Cas9
 
+
UVR8,reacts to UVB light
+
 
|-
 
|-
 
|'''Use in'''
 
|'''Use in'''
Line 18: Line 17:
 
|'''Backbone'''
 
|'''Backbone'''
 
|pSB1C3<br>  
 
|pSB1C3<br>  
|-
 
|'''Organism'''
 
|''Arabidopsis thaliana''
 
|-
 
|'''Source'''
 
|AG Weber, Freiburg
 
 
|-
 
|-
 
|'''Submitted by'''
 
|'''Submitted by'''
Line 29: Line 22:
 
|}
 
|}
  
==Biology and Usage==
+
This device derived from [https://parts.igem.org/Part:BBa_K1150034 BBa_K1150034] can be used in combination with all devices with [https://parts.igem.org/Part:BBa_K1150000 dCas9]. It contains a DNA sequence coding for a crRNA that binds complementary to VEGF4 target (GTGAGTGTGTGCGTGTGGGGTTGAGGGCGT).
  
 +
For more information about dCas9 devices [http://2013.igem.org/Team:Freiburg klick here].
  
 +
==Biology and Usage==
 +
 +
Freiburg 2013 used this plasmid to test the efficiency of target VEGF4 by activating or repressing a SEAP reporter gene.
 
<span class='h3bb'>
 
<span class='h3bb'>
 
==Sequence and Features==
 
==Sequence and Features==
Line 37: Line 34:
 
<partinfo>BBa_K1150039 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K1150039 SequenceAndFeatures</partinfo>
  
==Literature==
 
<small>
 
  
  
<!-- Uncomment this to enable Functional Parameter display
+
==Functional Parameters: Austin_UTexas==
===Functional Parameters===
+
<html>
 +
<body>
 
<partinfo>BBa_K1150039 parameters</partinfo>
 
<partinfo>BBa_K1150039 parameters</partinfo>
<!-- -->
+
<h3><center>Burden Imposed by this Part:</center></h3>
 +
<figure>
 +
<div class = "center">
 +
<center><img src = "https://static.igem.org/mediawiki/parts/f/fa/T--Austin_Utexas--no_burden_icon.png" style = "width:160px;height:120px"></center>
 +
</div>
 +
<figcaption><center><b>Burden Value: -1.0 ± 3.8% </b></center></figcaption>
 +
</figure>
 +
<p> Burden is the percent reduction in the growth rate of <i>E. coli</i> cells transformed with a plasmid containing this BioBrick (± values are 95% confidence limits). This BioBrick did not exhibit a burden that was significantly greater than zero (i.e., it appears to have little to no impact on growth). Therefore, users can depend on this part to remain stable for many bacterial cell divisions and in large culture volumes. Refer to any one of the
 +
<a href="https://parts.igem.org/Part:BBa_K3174002">BBa_K3174002</a> - <a href="https://parts.igem.org/Part:BBa_K3174007">BBa_K3174007</a> pages for more information on the methods, an explanation of the sources of burden,  and other conclusions from a large-scale measurement project conducted by the <a href="http://2019.igem.org/Team:Austin_UTexas">2019 Austin_UTexas team</a>.</p>
 +
<p>This functional parameter was added by the <a href="https://2020.igem.org/Team:Austin_UTexas/Contribution">2020 Austin_UTexas team.</a></p>
 +
</body>
 +
</html>
 +
 
 +
==Literature==
 +
<small>
 +
</small>

Latest revision as of 04:14, 25 August 2020

uniCAS RNAimer to target VEGF4


RNAimer (VEGF4 target)
Function Targeting VEGF4 with Cas9
Use in Mammalians
RFC standard RFC 25
Backbone pSB1C3
Submitted by [http://2013.igem.org/Team:Freiburg Freiburg 2013]

This device derived from BBa_K1150034 can be used in combination with all devices with dCas9. It contains a DNA sequence coding for a crRNA that binds complementary to VEGF4 target (GTGAGTGTGTGCGTGTGGGGTTGAGGGCGT).

For more information about dCas9 devices [http://2013.igem.org/Team:Freiburg klick here].

Biology and Usage

Freiburg 2013 used this plasmid to test the efficiency of target VEGF4 by activating or repressing a SEAP reporter gene.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 224
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 216


Functional Parameters: Austin_UTexas

BBa_K1150039 parameters

Burden Imposed by this Part:

Burden Value: -1.0 ± 3.8%

Burden is the percent reduction in the growth rate of E. coli cells transformed with a plasmid containing this BioBrick (± values are 95% confidence limits). This BioBrick did not exhibit a burden that was significantly greater than zero (i.e., it appears to have little to no impact on growth). Therefore, users can depend on this part to remain stable for many bacterial cell divisions and in large culture volumes. Refer to any one of the BBa_K3174002 - BBa_K3174007 pages for more information on the methods, an explanation of the sources of burden, and other conclusions from a large-scale measurement project conducted by the 2019 Austin_UTexas team.

This functional parameter was added by the 2020 Austin_UTexas team.

Literature