Difference between revisions of "Part:BBa K3037002"

Revision as of 15:31, 21 October 2019 (view source) ArnauP (Talk | contribs) (→‎1) prove of DNA-binding ability of dCas9 via EMSA) ← Older edit		Revision as of 15:32, 21 October 2019 (view source) ArnauP (Talk | contribs) (→‎1) prove of DNA-binding ability of dCas9 via EMSA) Newer edit →
Line 59:		Line 59:
	*1 x Reaction buffer - 20 mM Hepes buffer (pH 7.2)		*1 x Reaction buffer - 20 mM Hepes buffer (pH 7.2)
−	**100 mM Nacl	+	** 100 mM Nacl
−	**5 mM Mgcl2	+	** 5 mM Mgcl2
−	**0.1 mM EDTA	+	** 0.1 mM EDTA

---

Revision as of 15:32, 21 October 2019

dead CRISPR Associated Protein (dCas9)

dCas9
Function	Expression
Use in	Escherichia coli
RFC standard	Freiburg RFC25 standard
Backbone	pSB1C3
Experimental Backbone	pOCC97
Submitted by	Team: TU_Dresden 2019

Overview

The TU_Dresden 2019 team design this BioBrick in order to make a fusion protein with dCas9 (BBa_K3037003) in accordance to the Freiburg RFC25 standard. (more information)

dCas9 was inserted into the pOCC97 (BBa_K3037000) vector for transformation and expression in Escherichia coli.

There are many dCas9 biobricks already available but all of them are optimized for expression in mammalian cells. This is the first one that is codon optimized to be expressed in E. coli. New scope of in vitro applications of Cas9, which is normally used in vivo mainly.

Biology

dCas9 is part of the CRISPR System, an immune system of bacteria, which stores sequences of viral infections, recognizes them and cuts them apart. Therefore, the protein has the ability, when coupled with an guideRNA, to specifically bind to DNA. However, different to it's natural counterpart, dCas9 does no longer have the endonuclease activity. That means it is specifically binding different DNA-sequences without cutting them.

The targeted sequence is determined by the guideRNA bound to the dCas9 protein. Binding is done at 37°C for one hour. We can use the system by providing guideRNAs to locate to any target DNA sequence with a high specificity.

Characterization

Overview

We performed the following characterization experiments:

1) Prove of DNA-binding ability of dCas9 via Electrophoretic Mobility Shift Assay (EMSA) (Performed with BBa K3037005)

Experiments in Detail

1) prove of DNA-binding ability of dCas9 via EMSA

1. Materials:

• 100 ng of PCR amplified Sry gene

• 200 ng of dCas9-GFP

• 200 ng of guide RNA specifically targeting the amplified Sry gene

• 1 x Reaction buffer - 20 mM Hepes buffer (pH 7.2)

• • 100 mM Nacl

• • 5 mM Mgcl2

• • 0.1 mM EDTA

Six different guide RNAs were designed for targeting different regions of Sry gene. Using the online tool benchling and fasta sequence of Sry gene

1: AACTAAACATAAGAAAGTGA

2: GAAAGCCACACACTCAAGAA

3: ACTGGACAACAGGTTGTACA

4: GTAGGACAATCGGGTAACAT

5: TTCGCTGCAGAGTACCGAAG

6: CCATGAACGCATTCATCGTG

2. Methods:

1. We wanted to check if the overall efficiency of mobility shift increases when combinations of guide RNAs are used, so individual reactions with combinations of guide RNA were used.

2. Guide RNA, dCas9-GFP and Sry gene were incubated in reaction buffer (respective amounts mentioned in the materials section) for 37 °C for 1 hour.

3. Post incubation, they were mixed with loading dye without SDS, 20 % glycerol in Orange G dye and loaded onto 4-20 % gradient acrylamide- TBE precast gel. Gel was run for 3 hours at 75V in 1 x TBE buffer.

4. Gel was then stained using EtBR with 1:20000 dilution in 1x TBE for 10 minutes.

3.1 Results and Discussion of the 2 hours gel:

Lane 1 - There is a clear Sry gene at 800 base pairs and when Sry gene is incubated with only dCas9

Lane 2 - There is no shift seen in the position of the gene.

Lane 3 - When guide RNA 1 was incubated with the dCas9 DNA reaction mix, we see a shift in the mobility, this is because of the protein DNA interaction and this binding is hindering the gene mobility.

Lanes 5,6,7,8 and 9 – Different combinations of guide RNAs were used. From lane 7 and 8 we see the highest mobility shift.

From the electromobility shift assay performed above, we conclude that our expressed dCas9-GFP protein is functional and is able to successfully bind to gene with the help of appropriate guide RNAs.

3.2 Results and Discussion of the 3 hours gel:

This second gel was run more time in order to get rid of all the secondary structures of the RNA formed.

From lane 3 to 7, no difference in the mobility of Sry gene can be seen when only guide RNA is added to the reaction mix.

In Lane 8, 9 and 10 a mobility shift of the gene can be appreciated and in lane 11, when only guide RNA was loaded there is no bands.

In lane 12, dCas9 is in stacking part of gel, owing to higher molecular weight.

4. Conclusions:

- We have a functional dCas9 expressed, which is able bind successfully to Sry gene with the help of guide RNA.

- dCas9 on its own is unable to bind to Sry gene, suggesting that for binding guide RNA is required.

- Guide RNA on their own is unable to cause mobility shift of Sry gene.

Sequence

Design Notes

In the middle of the coding sequence there was an EcoRI site. As a forbidden restriction enzyme site, this needed to be mutated. Therefore a site directed mutagenesis PCR was preformed with the following primers:

Primer 1: gatcGAATTCGCGGCCGCTTCTAGATAAGGAGGTCAAAAATGgccggcGATAAGAAATACTCAATAGGC

Primer 2: CATAATAAGGAATaCGAAAAGTCAAG

Primer 3: CATAATAAGGAATaCGAAAAGTCAAG

Primer 4: gatcTCTGCAGCGGCCGCTACTAGTAttaaccggtGTCACCTCCTAGCTGACTCAAATC

The primers used to addapt this BioBrick to the Freiburg RFC25 standard were the following ones:

Prefix: GAATTCGCGGCCGCTTCTAGATAAGGAGGTCAAAAATGgccggc

Suffix: accggttaaTACTAGTAGCGGCCGCTGCAG

Find more information in here

References