Difference between revisions of "Part:BBa K2973011"

Latest revision as of 18:32, 20 October 2019

Toehold 13 β-Lactamase Geobacillus kaustophilus

This composite part consists of T7 Promoter (Part:BBa_J64997) and T7 Terminator (Part:BBa_K731721), the Ribosomal Binding Site (AGAGGAGA), a Toehold switch and the CDS of the β-lactamase without the signal peptide. Toehold switch systems are composed of two RNA strands referred to as the switch and trigger. The switch RNA contains the coding sequence of the regulated β-lactamase gene. Upstream of this coding sequence is a hairpin-based processing module containing both a strong RBS and a start codon that is followed by a common 21 nt linker sequence coding for low-molecular-weight amino acids added to the N terminus of the gene of interest. A single-stranded toehold sequence at the 5’ end of the hairpin module provides the initial binding site for the trigger RNA strand. This trigger molecule contains an extended single-stranded region that completes a branch migration process with the hairpin to expose the RBS and start codon, thereby initiating translation of the β-lactamase. This toehold was designed to detect the short 16S rRNA sequence GAAACCGGAGCTAATACCGGATAACACCGAAGACCG of Geobacillus kaustophilus. β-lactamase (EC 3.5.2.6) is a small monomeric enzyme(29kDa) that is produced by bacteria and gives them resistance to antibiotics with the β-lactam ring because of its ability to hydrolyze the amide bond in the β-lactam ring. This ability can be exploited in order to use β-lactamase as a protein reporter by providing the enzyme with its chromogenic substrate Nitrocefin. Nitrocefin is a chromogenic cephalosporin first reported in 1972 as a novel and straightforward substrate used to detect bacteria resistant to β-lactam antibiotics. Normally, a nitrocefin solution has a yellow color, but after its hydrolysis by β-lactamase, the color of the solution turns red, allowing in that way the detection of the enzyme.

Usage and Biology

A key aspect of our project is to provide a tool that can detect the DNA of any organism easily and reliably. To that end, we designed, a pool of universal toehold switches from hyperthermophile bacteria ,in silico. One of them was Toehold No.13. The reporter gene attached to the toehold switch is β-lactamase.

To assess the new toehold's performance, we performed a series of in vitro protein synthesis reactions. The in vitro transcription/ translation reactions were done using the PURExpress® In Vitro Protein Synthesis kit. To reduce the cost of the reaction, we lowered the reaction volume from 25 to 7 μL. The incubation time was 3 hours. After the 3-hour incubation in the cell-free system, the chromogenic substrate of β-lactamase, nitrocefin, was added and an additional 15-minute enzymatic assay was performed in the plate reader, at 37℃.

The performance of our designed Toehold 13 is depicted below.

Figure 1. Performance of toehold 13 in a β-lactamase enzymatic assay. Error bars represent standard deviation of n = 2 replicates.

The expression of β-lactamase under the regulation of Toehold 13 was noticeably low in the absence of a trigger sequence, while the 100nM trigger reaction easily reached levels of signal comparable to the positive control.

Sequence and Features

This toehold was designed in order to detect the 16S rRNA of the hyperthermophile Geobacillus kaustophilus. The design was made with the NUPACK software http://www.nupack.org/