Difference between revisions of "Part:BBa K2332314"
(2 intermediate revisions by the same user not shown) | |||
Line 33: | Line 33: | ||
===Usage and Biology=== | ===Usage and Biology=== | ||
+ | [[File:UCL-iGEM17_Light-induced Mammalian_Cell-Adhesion.gif|400px|thumb|right| | ||
+ | <center>'''Figure 1: Light-activation of E-cadherin.PhoCl fusion protein'''</center> ]] | ||
As stated in the original paper: "The photoconversion reaction is a violet light (~400 nm)-induced β-elimination reaction that extends the conjugated system of the chromophore with concomitant cleavage of the polypeptide backbone to form an ~66-residue N-terminal fragment and an ~166-residue C-terminal fragment that remain associated." | As stated in the original paper: "The photoconversion reaction is a violet light (~400 nm)-induced β-elimination reaction that extends the conjugated system of the chromophore with concomitant cleavage of the polypeptide backbone to form an ~66-residue N-terminal fragment and an ~166-residue C-terminal fragment that remain associated." | ||
The original protein has been engineered by Zhang et al. 2017 (Robert E. Campbell lab). The Campbell lab has sent the original plasmid to the UCL iGEM 2017 team as part of a collaboration and the team has made a BioBrick out of the engineered protein. | The original protein has been engineered by Zhang et al. 2017 (Robert E. Campbell lab). The Campbell lab has sent the original plasmid to the UCL iGEM 2017 team as part of a collaboration and the team has made a BioBrick out of the engineered protein. | ||
+ | |||
Latest revision as of 00:35, 23 October 2017
E-cadherin_PhoCl Fusion Protein, a photosensitive cell adhesion protein
E-cadherin_PhoCl Fusion Protein, a photosensitive cell adhesion protein | |
---|---|
Function | Photo-sensitive cell-cell adhesion |
Use in | Mammalian cells |
Abstraction Hierarchy | Part |
RFC standard | RFC10, RFC23 & RFC25 compatible |
Backbone | pSB1C3 |
Submitted by | [http://2017.igem.org/Team:UCL UCL iGEM 2017] |
As part of the UCL 2017's project "Light-induced Technologies" we investigated light sensitive proteins and their possible applications in synthetic genetic circuits. PhoCl is a novel (April 2017) photocleavable protein engineered from a green-to-red photoconvertible fluorescent protein.
Usage and Biology
As stated in the original paper: "The photoconversion reaction is a violet light (~400 nm)-induced β-elimination reaction that extends the conjugated system of the chromophore with concomitant cleavage of the polypeptide backbone to form an ~66-residue N-terminal fragment and an ~166-residue C-terminal fragment that remain associated."
The original protein has been engineered by Zhang et al. 2017 (Robert E. Campbell lab). The Campbell lab has sent the original plasmid to the UCL iGEM 2017 team as part of a collaboration and the team has made a BioBrick out of the engineered protein.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 2550
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 752
Illegal BamHI site found at 828
Illegal BamHI site found at 944
Illegal BamHI site found at 1868
Illegal BamHI site found at 2170
Illegal XhoI site found at 1552 - 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 208
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI site found at 65
Illegal BsaI site found at 465
Illegal BsaI site found at 872
Illegal BsaI site found at 1414
Illegal BsaI.rc site found at 306
Illegal BsaI.rc site found at 3183
Functional Parameters
Protein data table for BioBrick BBa_ automatically created by the BioBrick-AutoAnnotator version 1.0 | ||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Nucleotide sequence in RFC 10: (underlined part encodes the protein) AGCTTGGTACCTCCACCATGGGAGCC ... GGAGGTACCTAACCTATTCTATAG ORF from nucleotide position 18 to 3425 (excluding stop-codon) | ||||||||||||||||||||||||||||||||||||||||||||||
Amino acid sequence: (RFC 25 scars in shown in bold, other sequence features underlined; both given below)
| ||||||||||||||||||||||||||||||||||||||||||||||
Sequence features: (with their position in the amino acid sequence, see the list of supported features)
| ||||||||||||||||||||||||||||||||||||||||||||||
Amino acid composition:
| ||||||||||||||||||||||||||||||||||||||||||||||
Amino acid counting
| Biochemical parameters
| |||||||||||||||||||||||||||||||||||||||||||||
Plot for hydrophobicity, charge, predicted secondary structure, solvent accessability, transmembrane helices and disulfid bridges | ||||||||||||||||||||||||||||||||||||||||||||||
Codon usage
| ||||||||||||||||||||||||||||||||||||||||||||||
Alignments (obtained from PredictProtein.org) There were no alignments for this protein in the data base. The BLAST search was initialized and should be ready in a few hours. | ||||||||||||||||||||||||||||||||||||||||||||||
Predictions (obtained from PredictProtein.org) | ||||||||||||||||||||||||||||||||||||||||||||||
There were no predictions for this protein in the data base. The prediction was initialized and should be ready in a few hours. | ||||||||||||||||||||||||||||||||||||||||||||||
The BioBrick-AutoAnnotator was created by TU-Munich 2013 iGEM team. For more information please see the documentation. If you have any questions, comments or suggestions, please leave us a comment. |
Reference
Zhang W, Lohman AW, Zhuravlova Y, Lu X, Wiens MD, Hoi H, Yaganoglu S, Mohr MA, Kitova EN, Klassen JS, Pantazis P, Thompson RJ, Campbell RE. Optogenetic control with a photocleavable protein, PhoCl. Nat Methods. 14(4):391-394 (2017) NCBI