Difference between revisions of "Part:BBa K2273066"
(→Signal Peptide Toolbox) |
(→Signal Peptide Toolbox) |
||
Line 38: | Line 38: | ||
− | To cope with this issue, the [http://2017.igem.org/Team:TU_Dresden iGEM team of TU Dresden 2017 (EncaBcillus - It's a trap!)] developed a novel shotgun approach high-throughput signal peptide screening vector system for targeted secretion in <i>B. subtilis</i>, or “Signal Peptide Toolbox” for short. | + | To cope with this issue, the [http://2017.igem.org/Team:TU_Dresden iGEM team of TU Dresden 2017 (EncaBcillus - It's a trap!)] developed a novel shotgun approach high-throughput signal peptide screening vector system for targeted secretion in <i>B. subtilis</i>, or “Signal Peptide Toolbox” for short. |
− | The Signal Peptide Toolbox can be used by any team to increase secretion efficiency of heterologous and recombinant proteins in <i>Bacillus subtilis</i>. The following list of signal peptides gives an overview of all signal peptides which are currently part of the Signal Peptide Toolbox. | + | The Signal Peptide Toolbox contains the so-called [https://parts.igem.org/Part:BBa_K2273106 Evaluation Vector] and the Signal Peptide Mix which is made of equal amounts of all signal peptides which are part of the Signal Peptide Toolbox. It can be used by any team to increase secretion efficiency of heterologous and recombinant proteins in <i>Bacillus subtilis</i>. |
+ | |||
+ | |||
+ | For screening, in a first step, the coding sequence of the protein of interest as well as a promotor of choice would be cloned into the Evaluation Vector. In a second step, all signal peptides of the Signal Peptide Mix would be integrated into the Evaluation Vector at once. Finally, the randomly transformed bacteria colonies are screened for their specific secretion efficiency using a protein of interest specific assay. Those strains, which reassemble the secretion level of choice the best, can then be sequenced to reversely identify the integrated signal peptide. | ||
+ | |||
+ | |||
+ | The following list of signal peptides gives an overview of all signal peptides which are currently part of the Signal Peptide Mix of the Signal Peptide Toolbox. | ||
<table border="1" style="border-collapse:collapse;" cellpadding="5" summary=""> | <table border="1" style="border-collapse:collapse;" cellpadding="5" summary=""> |
Revision as of 01:03, 23 September 2017
SpoIID signal peptide of B. subtilis lytic transglycosylase
The SpoIID signal peptide is part of the Signal Peptide Toolbox of [http://2017.igem.org/Team:TU_Dresden iGEM Team TU Dresden 2017 (EncaBcillus - It's a trap!)].
The signal peptide (amino acids 1 to 34) of Bacillus subtilis lytic transglycosylase (cell wall hydrolase involved in dissolution of the septal cell wall, Uniprot [http://www.uniprot.org/uniprot/P07372 P07372]) targets for protein secretion via the Sec-SRP secretion pathway (Brockmeier et al, 2006).
This part was generated in a modified version of RFC25, where a strong Shine Dalgarno Sequence (SD) is included, and has the following prefix and suffix:
Prefix with | EcoRI, NotI, XbaI and SD | GAATTCGCGGCCGCTTCTAGATAAGGAGGTCAAAA |
Suffix with | AgeI, SpeI, NotI and PstI | ACCGGTTAATACTAGTAGCGGCCGCTGCAGA |
Sites of restriction enzymes generating compatible overhangs are indicated by sharing one color. (EcoRI and PstI are marked in blue, NotI in green, XbaI and SpeI in red and AgeI in orange. Additionally, the Shine-Dalgarno sequence is marked in silver and the stop codon is underlined.)
This part is used in the 2017 TU Dresden iGEM project [http://2017.igem.org/Team:TU_Dresden EncaBcillus - It's a trap!] and part of the Signal Peptide Toolbox.
Signal Peptide Toolbox
The GRAM-positive model organism Bacillus subtilis is considered a perfect host for heterologous and recombinant protein secretion due to its extracellular chaperones, natural protein secretion capacity and well-studied genetics (van Dijl and Hecker, 2013). To increase protein production rates of such proteins, it is feasible to enhance the secretion efficiency. The easiest method to realise this, is to tag the protein of interest with a so-called signal peptide of B. subtilis' general protein secretion pathway Sec-SRP which dictates the secretion of proteins into the surrounding supernatant of the cell (Fu et al, 2007).
Though the Sec-SRP protein secretion pathway of B. subtilis contains more than 170 distinct signal peptides, every single SP varies in its secretion efficiency in dependency on the protein fused to it. To date, it is impossible to predict this dependency via studying the genetic code of the SPs and the protein of interest (Brockmeier et al, 2006).
To cope with this issue, the [http://2017.igem.org/Team:TU_Dresden iGEM team of TU Dresden 2017 (EncaBcillus - It's a trap!)] developed a novel shotgun approach high-throughput signal peptide screening vector system for targeted secretion in B. subtilis, or “Signal Peptide Toolbox” for short.
The Signal Peptide Toolbox contains the so-called Evaluation Vector and the Signal Peptide Mix which is made of equal amounts of all signal peptides which are part of the Signal Peptide Toolbox. It can be used by any team to increase secretion efficiency of heterologous and recombinant proteins in Bacillus subtilis.
For screening, in a first step, the coding sequence of the protein of interest as well as a promotor of choice would be cloned into the Evaluation Vector. In a second step, all signal peptides of the Signal Peptide Mix would be integrated into the Evaluation Vector at once. Finally, the randomly transformed bacteria colonies are screened for their specific secretion efficiency using a protein of interest specific assay. Those strains, which reassemble the secretion level of choice the best, can then be sequenced to reversely identify the integrated signal peptide.
The following list of signal peptides gives an overview of all signal peptides which are currently part of the Signal Peptide Mix of the Signal Peptide Toolbox.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]