Difference between revisions of "Collections/Best Basic Part"

m
m
Line 1: Line 1:
 +
{{Catalog/MainLinks}}
 +
{{TOCright}}
 +
{{Catalog/Curation}}
 +
 
<parttable>award_winning_parts_basic_parts</parttable>
 
<parttable>award_winning_parts_basic_parts</parttable>

Revision as of 17:51, 17 May 2017

This collection is under curation by iGEM HQ. New parts and information are currently being added to this page.


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K1582001sJanus from Trichoderma reeseiCodingDongqi Bao2281 . . . cttctgtgccagaccgccgtcggtgcttga
BBa_K1699001Human short TERT promoterRegulatoryEmil Ruvinov378  . . . ccctccccttcctttccgcggccccgccct
BBa_K1893013Small transcription activating RNA (STAR)RNAAkash Bhattacharjee1044 . . . caaagcccgccgaaaggcgggctttttttt
BBa_K2033000N-dodecanoyl-L-homoserine lactone (C(12)-HSL) Sender- AubISignallingBrady Dennison714  . . . aaattaggcctggtgggcgccgaggcctaa
BBa_K2201004Nucleotide Transporter PtNTT2 from Phaeodactylum tricornutumCodingChristopher M. Whitford17281 . . . atggaagcgaaaaccaacaaagaaaaataa
BBa_K2230022STM1128/pSB1C3CodingYi-Lun Huang & Pei-Hong Chen14971 . . . gaaaaacctgaaccaaaggtgacattatga
BBa_K2259000SynORI framework RNA II - Replication Initiator (Group A)ProjectLaurynas Karpus67014 . . . ttcttcctgttcctggtcttttgctcacat
BBa_K2668010Cerberus : A Molecular Binding Plateform (mSA2-CBM3a-AzF)CodingYounes Bouchiba1098  . . . accacgattcctccatcattggacgatccg
BBa_K2748000U24 protein from human herpesvirus 6ACodingXiaowen Mao264  . . . gttttccatgtgaatcgtcaaaggcgatga
BBa_K2753003pSB1C3-obGES cdsCodingWEI KUANGYI 17042 . . . tacgttgacgcgctgttctttacccaataa
BBa_K2818001Cas13d-NLS-ADARCodingDanny Teo Shun Xiang4143  . . . accgagcaggaccagttctcactcacgtaa
BBa_K3111011DARPin929CodingMatas Deveikis4773 . . . gaggtactccaaaaggccgcaaagctcaat
BBa_K3187028Sortase A7M (Ca2+-independent variant)CodingiGEM TU_Darmstadt 20194502 . . . atctttgtagctacagaagtcaaactcgag
BBa_K3264000NT-2Rep-CTCodingXinyou Chang1041  . . . caggatagcgtgggtcagtatgtgggctaa
BBa_K3352001Φ29 DNA Polymerase with His-Tag and GS linker SequenceCodingJoyce Ting1773-1 . . . ctagtggacgacacctttacgattaaataa
BBa_K3407004Fox-1 RBD: a protein domain binding strongly and specifically to RNA sequence UGCAUGU.CodingJavier Navarro Delgado363-1 . . . aagacggtgaacccgtacaccaatggctaa
BBa_K3484000Intein-mediated T3(THRB) → sfGFPProtein_DomainAndreu Pascuet & Eduard Sune2268-1 . . . atcgattacaaagatgacgacgacaaataa
BBa_K3730035Anti-hGPC3-scfv,a single chain variable antibody of human GPC3 protein. In our program, it is fused Protein_DomainLinhe Yang801-1 . . . ttcggtcagggtactaaactggagatcaag
BBa_K3758042Prrn16, rrn16 promoter (short version) Nicotiana tabacum RegulatoryMichael Burgis64-1 . . . gagggggcagggatggctatatttctggga
BBa_K4011003Fre-SttHCodingPeijia Lai2307-1 . . . tattttgcggcgatgggccagcgcgtgtaa
BBa_K4162005Hammerhead ribozymeRNAWeiwen Chen57-1 . . . actgaagagactggacgaaaccaataggtc
BBa_K4273000hSOD-linker-hCatalaseCodingXinyue Yao2094-1 . . . gcgaacctgcatcatcatcatcatcattaa
BBa_K4387000Nitric Oxide Sensing Promoter pNorVβRegulatoryJana Mehdy, Lea Bruellmann, Marine Mausy256-1 . . . caatctgcaattagcaagacatctttttag