Difference between revisions of "Part:BBa K2040122"
Chilam Poon (Talk | contribs) |
Chilam Poon (Talk | contribs) |
||
(5 intermediate revisions by the same user not shown) | |||
Line 1: | Line 1: | ||
__NOTOC__ | __NOTOC__ | ||
− | <partinfo> | + | <partinfo>BBa_K2040122 short</partinfo> |
− | A SV40 nuclear localization signal was fused to the phototoxic protein KillerRed. | + | A SV40 nuclear localization signal(NLS) was fused to the phototoxic protein KillerRed. |
<!-- Add more about the biology of this part here --> | <!-- Add more about the biology of this part here --> | ||
Line 12: | Line 12: | ||
KillerRed effectively killed bacterial cells when exposed to white light for several minutes. However, in eukaryotic cells, irradiation of KillerRed localized in cell cytosol has a weak effect on cell survival<sup>[2]</sup>. | KillerRed effectively killed bacterial cells when exposed to white light for several minutes. However, in eukaryotic cells, irradiation of KillerRed localized in cell cytosol has a weak effect on cell survival<sup>[2]</sup>. | ||
The following two ways have been found to be effective for killing the eukaryotic cells using KillerRed: (1) via an apoptotic pathway using KillerRed targeted to mitochondria, and (2) via membrane lipid oxidation using membrane-localized KillerRed. <sup>[2]</sup> | The following two ways have been found to be effective for killing the eukaryotic cells using KillerRed: (1) via an apoptotic pathway using KillerRed targeted to mitochondria, and (2) via membrane lipid oxidation using membrane-localized KillerRed. <sup>[2]</sup> | ||
− | |||
− | |||
− | + | Chromatin is also a ROS-sensitive intracellular localization.So we designed to fuse a SV40 nuclear localization signal to KillerRed protein in order to increase efficiency of KillerRed-mediated oxidative stress. | |
+ | |||
+ | So we tried to fused a SV40 nuclear localization signal(5' CCTCCCAAGAAGAAGCGCAAGGTC 3') to the KillerRed protein in order to target the chromatin in nucleus. | ||
==References== | ==References== | ||
Line 26: | Line 26: | ||
<!-- --> | <!-- --> | ||
<span class='h3bb'>Sequence and Features</span> | <span class='h3bb'>Sequence and Features</span> | ||
− | <partinfo> | + | <partinfo>BBa_K2040122 SequenceAndFeatures</partinfo> |
<!-- Uncomment this to enable Functional Parameter display | <!-- Uncomment this to enable Functional Parameter display | ||
===Functional Parameters=== | ===Functional Parameters=== | ||
− | <partinfo> | + | <partinfo>BBa_K2040122 parameters</partinfo> |
<!-- --> | <!-- --> |
Latest revision as of 05:10, 22 October 2016
KillerRed + NLS
A SV40 nuclear localization signal(NLS) was fused to the phototoxic protein KillerRed.
Usage and Biology
KillerRed(BBa_K1184000) is a red fluorescent protein that produces reactive oxygen species (ROS) in the presence of yellow-orange light (540-585 nm). It is engineered from anm2CP to be phototoxic. Expression of KillerRed and irradiation with light may act a kill-switch for biosafety applications. More details about KillerRed see [http://2013.igem.org/Team:Carnegie_Mellon/KillerRed 2013 Carnegie_Mellon].
KillerRed effectively killed bacterial cells when exposed to white light for several minutes. However, in eukaryotic cells, irradiation of KillerRed localized in cell cytosol has a weak effect on cell survival[2]. The following two ways have been found to be effective for killing the eukaryotic cells using KillerRed: (1) via an apoptotic pathway using KillerRed targeted to mitochondria, and (2) via membrane lipid oxidation using membrane-localized KillerRed. [2]
Chromatin is also a ROS-sensitive intracellular localization.So we designed to fuse a SV40 nuclear localization signal to KillerRed protein in order to increase efficiency of KillerRed-mediated oxidative stress.
So we tried to fused a SV40 nuclear localization signal(5' CCTCCCAAGAAGAAGCGCAAGGTC 3') to the KillerRed protein in order to target the chromatin in nucleus.
References
[1]2013 Carnegie_Mellon ;http://2013.igem.org/Team:Carnegie_Mellon/KillerRed
[2]Genetically-encoded photosensitizer KillerRed; http://evrogen.com/products/KillerRed/KillerRed_Detailed_description.shtml
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 714
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 151
Illegal BsaI.rc site found at 442