Difference between revisions of "Part:BBa K2009602"

 
 
(3 intermediate revisions by the same user not shown)
Line 1: Line 1:
  
 +
 +
 +
<partinfo>BBa_K2009602 short</partinfo>
 +
 +
<p style="font-weight:bold; font-size:20px;">Sequence And Features</p>
 +
<partinfo>BBa_K2009602 SequenceAndFeatures</partinfo>
 +
 +
<p style="font-weight:bold; font-size:20px;">introduction</p>
 +
<hr>
 +
<p > </p>
 +
 +
 +
sfGFP11 length: 114bp
 +
<br>
 +
Derived from:synthesis from Sangon
 +
<br>
 +
<html>
 +
<a href="https://parts.igem.org/Part:BBa_J23100"> BBa_J23100 </a>
 +
</html>: promoter:
 +
<br>
 +
<html>
 +
<a href="https://parts.igem.org/Part:BBa_B0030"> BBa_B0030 </a>
 +
</html>: RBS
 +
 +
sfGFP11——PSB1C3 is an expression plasmid which insert sfGFP11 into PSB1C3.
 +
before sfGFP11, we add a linker(gatggagggtctggtggcggatca) to achieve our goal.SfGFP11 is a part of GFP(from 214bp to 230bp), GFP has been mutated to improve its solubilityand self-associating activity. When it express, it will emit green fluorescenceslightly under the fluorescence microscope.
 +
 +
We try to find anideal protein tag to be work both invivo and invitro and it can provide a sensitive measurable signalwhich don’t need external chemical reagents or substrates. Finally we find away to accomplish this goal—— dividing GFP into sfGFP1-10and sfGFP11. Either the sfGFP1-10 or sfGFP11 will emit green fluorescence slightly under the fluorescencemicroscope. However, when sfGFP1-10 and sfGFP11 express insame cell, they will interact each other and emit more intense fluorescence thaneach of them. The split GFP system is simple and does not change fusion proteinsolubility.
 +
 +
Usage and biology:The split GFP system has manypractical applications. Obtaining soluble, well-folded recombinant proteins fordownstream applications requires screening large numbers of protein variants (mutants,fragments, fusion tags, folding partners) and testing many expression orrefolding conditions.(Ste´phanieCabantous, Thomas C Terwilliger & Geoffrey S Waldo,2005)
 +
 +
<p style="font-weight:bold; font-size:20px;">Part Sequence</p>
 +
<hr>
 +
 +
ttgacggctagctcagtcctaggtacagtgctagctactagagattaaagaggagaaatactagagagaccacatggtccttcatgagtatgtaaatgctgctgggattaca
 +
<br>
 +
(All the sequence has been testified by Sangon)
 +
<!-- Add more about the biology of this part here
 +
===Usage and Biology===
 +
 +
<!-- --> 
 +
 +
 +
<!-- Uncomment this to enable Functional Parameter display
 +
===Functional Parameters===
 +
<partinfo>BBa_K2009602 parameters</partinfo>
 +
<!-- -->

Latest revision as of 03:13, 16 September 2016


sfGFP11 with promoter and RBS

Sequence And Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal NheI site found at 7
    Illegal NheI site found at 30
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 68

introduction


sfGFP11 length: 114bp
Derived from:synthesis from Sangon
BBa_J23100 : promoter:
BBa_B0030 : RBS

sfGFP11——PSB1C3 is an expression plasmid which insert sfGFP11 into PSB1C3. before sfGFP11, we add a linker(gatggagggtctggtggcggatca) to achieve our goal.SfGFP11 is a part of GFP(from 214bp to 230bp), GFP has been mutated to improve its solubilityand self-associating activity. When it express, it will emit green fluorescenceslightly under the fluorescence microscope.

We try to find anideal protein tag to be work both invivo and invitro and it can provide a sensitive measurable signalwhich don’t need external chemical reagents or substrates. Finally we find away to accomplish this goal—— dividing GFP into sfGFP1-10and sfGFP11. Either the sfGFP1-10 or sfGFP11 will emit green fluorescence slightly under the fluorescencemicroscope. However, when sfGFP1-10 and sfGFP11 express insame cell, they will interact each other and emit more intense fluorescence thaneach of them. The split GFP system is simple and does not change fusion proteinsolubility.

Usage and biology:The split GFP system has manypractical applications. Obtaining soluble, well-folded recombinant proteins fordownstream applications requires screening large numbers of protein variants (mutants,fragments, fusion tags, folding partners) and testing many expression orrefolding conditions.(Ste´phanieCabantous, Thomas C Terwilliger & Geoffrey S Waldo,2005)

Part Sequence

ttgacggctagctcagtcctaggtacagtgctagctactagagattaaagaggagaaatactagagagaccacatggtccttcatgagtatgtaaatgctgctgggattaca
(All the sequence has been testified by Sangon)