Difference between revisions of "Promoters/Catalog/B. subtilis/Positive"
(3 intermediate revisions by 2 users not shown) | |||
Line 1: | Line 1: | ||
− | [[Image:PositivePromoter.png|right| | + | [[Image:PositivePromoter.png|right|200px]] |
− | + | ||
− | + | The ''B. subtilis'' promoters of this section is the ones that are said to be '''positively regulated'''. It means that meaning their expression level increase with the help of another third party protein called transcription activator (This category exclude the sigma factor protein itself). With the appropriate protein, you would be able to increase the activity of your promoter. Please read the description and characterization of each parts for more details. | |
− | + | <br style="clear:both" /> | |
− | + | ===Positively regulated ''B. subtilis'' σ<sup>A</sup> promoters=== | |
− | + | This section lists the promoters recognized by [[Help:Promoters/Prokaryotic RNAP#E. coli RNA polymerases|''B. subtilis'' σ<sup>A</sup> RNA polymerase]] sub-unit. σ<sup>A</sup> is the major ''B. subtilis'' sigma factor that is present under most growth conditions (but maximal during exponential growth phase).<br> | |
− | This section lists promoters | + | |
− | + | <parttable>promoter_subtilis_positive_sigmaA</parttable> | |
+ | |||
+ | ===Positively regulated ''B. subtilis'' σ<sup>B</sup> promoters=== | ||
+ | |||
+ | This section lists promoters that are recognized by [[Help:Promoters/Prokaryotic RNAP#E. coli RNA polymerases|''B. subtilis'' σ<sup>B</sup> RNA polymerase]]. σ<sup>B</sup> is the polymerase subunit that is the most present during the stationary growth phase. You can use these promoters if you want your construct to be mostly expressed during stationary growth phase or under starvation conditions. | ||
+ | |||
+ | <parttable>promoter_subtilis_positive_sigmaB</parttable> | ||
+ | |||
+ | <html> | ||
+ | <style> | ||
+ | #assembly_plasmid_table {margin-left:auto;margin-right:auto; border: 3px solid #444444;} | ||
+ | #assembly_plasmid_table td {background-color:#eeeeee; padding: 5px; font-size: 12px;} | ||
+ | #assembly_plasmid_table th {background-color: #aaaaaa;padding: 5px; font-size:14px;} | ||
+ | </style> | ||
+ | </html> |
Latest revision as of 13:50, 31 October 2011
The B. subtilis promoters of this section is the ones that are said to be positively regulated. It means that meaning their expression level increase with the help of another third party protein called transcription activator (This category exclude the sigma factor protein itself). With the appropriate protein, you would be able to increase the activity of your promoter. Please read the description and characterization of each parts for more details.
Positively regulated B. subtilis σA promoters
This section lists the promoters recognized by B. subtilis σA RNA polymerase sub-unit. σA is the major B. subtilis sigma factor that is present under most growth conditions (but maximal during exponential growth phase).
Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
---|---|---|---|---|---|---|---|
BBa_K090504 | Gram-Positive Strong Constitutive Promoter | . . . acatgggaaaactgtatgtatttgatcctc | 239 | 2275 | It's complicated |
Positively regulated B. subtilis σB promoters
This section lists promoters that are recognized by B. subtilis σB RNA polymerase. σB is the polymerase subunit that is the most present during the stationary growth phase. You can use these promoters if you want your construct to be mostly expressed during stationary growth phase or under starvation conditions.
There are no parts for this table