Difference between revisions of "Promoters/Catalog/B. subtilis/Positive"

 
(4 intermediate revisions by 2 users not shown)
Line 1: Line 1:
All the promoters on this page are ''B. subtilis'' promoters that are '''positively regulated''' meaning that increased levels of at least one transcription factor (other than the sigma factor) will increase the activity of these promoters.
+
[[Image:PositivePromoter.png|right|200px]]
  
==Positively regulated ''B. subtilis'' &sigma;<sup>A</sup> promoters==
+
The ''B. subtilis'' promoters of this section is the ones that are said to be '''positively regulated'''. It means that meaning their expression level increase with the help of another third party protein called transcription activator (This category exclude the sigma factor protein itself). With the appropriate protein, you would be able to increase the activity of your promoter. Please read the description and characterization of each parts for more details.
This section lists promoters that are recognized by [[Help:Promoters/Prokaryotic RNAP#E. coli RNA polymerases|''B. subtilis'' &sigma;<sup>A</sup> RNAP]].  &sigma;<sup>A</sup> is the major ''B. subtilis'' sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).<br>
+
<br style="clear:both" />
  
Insert table
+
===Positively regulated ''B. subtilis'' &sigma;<sup>A</sup> promoters===
  
==Positively regulated ''B. subtilis'' &sigma;<sup>B</sup> promoters==
+
This section lists the promoters recognized by [[Help:Promoters/Prokaryotic RNAP#E. coli RNA polymerases|''B. subtilis'' &sigma;<sup>A</sup> RNA polymerase]] sub-unit.  &sigma;<sup>A</sup> is the major ''B. subtilis'' sigma factor that is present under most growth conditions (but maximal during exponential growth phase).<br>
This section lists promoters that are recognized by [[Help:Promoters/Prokaryotic RNAP#E. coli RNA polymerases|''B. subtilis'' &sigma;<sup>B</sup> RNAP]].  &sigma;<sup>B</sup> is the major stationary phase ''E. coli'' sigma factor.  Use these promoters when you want high promoter activity during stationary phase or during starvation. <br>
+
  
Insert table
+
<parttable>promoter_subtilis_positive_sigmaA</parttable>
 +
 
 +
===Positively regulated ''B. subtilis'' &sigma;<sup>B</sup> promoters===
 +
 
 +
This section lists promoters that are recognized by [[Help:Promoters/Prokaryotic RNAP#E. coli RNA polymerases|''B. subtilis'' &sigma;<sup>B</sup> RNA polymerase]]. &sigma;<sup>B</sup> is the polymerase subunit that is the most present during the stationary growth phase. You can use these promoters if you want your construct to be mostly expressed during stationary growth phase or under starvation conditions.
 +
 
 +
<parttable>promoter_subtilis_positive_sigmaB</parttable>
 +
 
 +
<html>
 +
<style>
 +
#assembly_plasmid_table {margin-left:auto;margin-right:auto; border: 3px solid #444444;}
 +
#assembly_plasmid_table td {background-color:#eeeeee; padding: 5px; font-size: 12px;}
 +
#assembly_plasmid_table th {background-color: #aaaaaa;padding: 5px; font-size:14px;}
 +
</style>
 +
</html>

Latest revision as of 13:50, 31 October 2011

PositivePromoter.png

The B. subtilis promoters of this section is the ones that are said to be positively regulated. It means that meaning their expression level increase with the help of another third party protein called transcription activator (This category exclude the sigma factor protein itself). With the appropriate protein, you would be able to increase the activity of your promoter. Please read the description and characterization of each parts for more details.

Positively regulated B. subtilis σA promoters

This section lists the promoters recognized by B. subtilis σA RNA polymerase sub-unit. σA is the major B. subtilis sigma factor that is present under most growth conditions (but maximal during exponential growth phase).


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_K090504Gram-Positive Strong Constitutive Promoter . . . acatgggaaaactgtatgtatttgatcctc2392275It's complicated

Positively regulated B. subtilis σB promoters

This section lists promoters that are recognized by B. subtilis σB RNA polymerase. σB is the polymerase subunit that is the most present during the stationary growth phase. You can use these promoters if you want your construct to be mostly expressed during stationary growth phase or under starvation conditions.


There are no parts for this table