Revision history of "Part:BBa K4047000:Hard Information"

Diff selection: Mark the radio boxes of the revisions to compare and hit enter or the button at the bottom.
Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.

  • (cur | prev) 17:52, 4 October 2021‎ Anniequyan (Talk | contribs)‎ . . (702 bytes) (+702)‎ . . (Created page with "This is the forward primer for transaldolase. The overlap sequence (acacaggaaacagaccatgg) allows proper Gibson assembly with the pGEM-tal backbone. The intermediate aattc sequ...")